ID: 1156887390

View in Genome Browser
Species Human (GRCh38)
Location 18:42151095-42151117
Sequence TTTGCGAAGCCCCATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156887390_1156887392 1 Left 1156887390 18:42151095-42151117 CCATCATCATGGGGCTTCGCAAA No data
Right 1156887392 18:42151119-42151141 ACAAGAAACAAGCTTTTATTGGG No data
1156887390_1156887391 0 Left 1156887390 18:42151095-42151117 CCATCATCATGGGGCTTCGCAAA No data
Right 1156887391 18:42151118-42151140 AACAAGAAACAAGCTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156887390 Original CRISPR TTTGCGAAGCCCCATGATGA TGG (reversed) Intergenic
No off target data available for this crispr