ID: 1156887437

View in Genome Browser
Species Human (GRCh38)
Location 18:42151767-42151789
Sequence AAGTGTGCCCAGGGTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156887437_1156887443 23 Left 1156887437 18:42151767-42151789 CCAGCAACACCCTGGGCACACTT No data
Right 1156887443 18:42151813-42151835 CATTGAGCTTATTTACCTATAGG No data
1156887437_1156887445 25 Left 1156887437 18:42151767-42151789 CCAGCAACACCCTGGGCACACTT No data
Right 1156887445 18:42151815-42151837 TTGAGCTTATTTACCTATAGGGG No data
1156887437_1156887444 24 Left 1156887437 18:42151767-42151789 CCAGCAACACCCTGGGCACACTT No data
Right 1156887444 18:42151814-42151836 ATTGAGCTTATTTACCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156887437 Original CRISPR AAGTGTGCCCAGGGTGTTGC TGG (reversed) Intergenic
No off target data available for this crispr