ID: 1156890769

View in Genome Browser
Species Human (GRCh38)
Location 18:42187180-42187202
Sequence CTGTGCACACACATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156890765_1156890769 28 Left 1156890765 18:42187129-42187151 CCTCTGGCCATCAGGAGCATTAA No data
Right 1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG No data
1156890766_1156890769 21 Left 1156890766 18:42187136-42187158 CCATCAGGAGCATTAATTGTAAT No data
Right 1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG No data
1156890767_1156890769 -6 Left 1156890767 18:42187163-42187185 CCATTTCAGCCAAACTGCTGTGC No data
Right 1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156890769 Original CRISPR CTGTGCACACACATGAAGCC TGG Intergenic
No off target data available for this crispr