ID: 1156892156

View in Genome Browser
Species Human (GRCh38)
Location 18:42203344-42203366
Sequence CTGCTGATCTTGTGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156892148_1156892156 21 Left 1156892148 18:42203300-42203322 CCTCAGCCCCAAGCACTTGGACC No data
Right 1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG No data
1156892150_1156892156 14 Left 1156892150 18:42203307-42203329 CCCAAGCACTTGGACCTCACATG No data
Right 1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG No data
1156892152_1156892156 0 Left 1156892152 18:42203321-42203343 CCTCACATGTCAGCTCTTAGCAC No data
Right 1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG No data
1156892151_1156892156 13 Left 1156892151 18:42203308-42203330 CCAAGCACTTGGACCTCACATGT No data
Right 1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG No data
1156892149_1156892156 15 Left 1156892149 18:42203306-42203328 CCCCAAGCACTTGGACCTCACAT No data
Right 1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156892156 Original CRISPR CTGCTGATCTTGTGGGAAAC TGG Intergenic
No off target data available for this crispr