ID: 1156892777

View in Genome Browser
Species Human (GRCh38)
Location 18:42208955-42208977
Sequence GAAAAACCTCCCTGTAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156892777_1156892787 20 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892787 18:42208998-42209020 ATAAGGGGTGAGGAGGAGAAAGG No data
1156892777_1156892780 3 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892780 18:42208981-42209003 TCTCATCCCATTAGGTCATAAGG No data
1156892777_1156892781 4 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892781 18:42208982-42209004 CTCATCCCATTAGGTCATAAGGG No data
1156892777_1156892786 13 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892786 18:42208991-42209013 TTAGGTCATAAGGGGTGAGGAGG No data
1156892777_1156892779 -5 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892779 18:42208973-42208995 TTTTCTGGTCTCATCCCATTAGG No data
1156892777_1156892785 10 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892785 18:42208988-42209010 CCATTAGGTCATAAGGGGTGAGG No data
1156892777_1156892782 5 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892782 18:42208983-42209005 TCATCCCATTAGGTCATAAGGGG No data
1156892777_1156892788 21 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892788 18:42208999-42209021 TAAGGGGTGAGGAGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156892777 Original CRISPR GAAAAACCTCCCTGTAATAT TGG (reversed) Intergenic
No off target data available for this crispr