ID: 1156892785

View in Genome Browser
Species Human (GRCh38)
Location 18:42208988-42209010
Sequence CCATTAGGTCATAAGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156892777_1156892785 10 Left 1156892777 18:42208955-42208977 CCAATATTACAGGGAGGTTTTTC No data
Right 1156892785 18:42208988-42209010 CCATTAGGTCATAAGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156892785 Original CRISPR CCATTAGGTCATAAGGGGTG AGG Intergenic
No off target data available for this crispr