ID: 1156892982

View in Genome Browser
Species Human (GRCh38)
Location 18:42211055-42211077
Sequence GATTGGGGTTGCAACTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156892970_1156892982 27 Left 1156892970 18:42211005-42211027 CCTCAGACCCTGCTTCTCTCCAA No data
Right 1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG No data
1156892981_1156892982 -10 Left 1156892981 18:42211042-42211064 CCTGGAAGCGGCAGATTGGGGTT No data
Right 1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG No data
1156892974_1156892982 8 Left 1156892974 18:42211024-42211046 CCAAAACGCTCCAAGGAGCCTGG No data
Right 1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG No data
1156892972_1156892982 19 Left 1156892972 18:42211013-42211035 CCTGCTTCTCTCCAAAACGCTCC No data
Right 1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG No data
1156892977_1156892982 -2 Left 1156892977 18:42211034-42211056 CCAAGGAGCCTGGAAGCGGCAGA No data
Right 1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG No data
1156892971_1156892982 20 Left 1156892971 18:42211012-42211034 CCCTGCTTCTCTCCAAAACGCTC No data
Right 1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156892982 Original CRISPR GATTGGGGTTGCAACTGACC TGG Intergenic
No off target data available for this crispr