ID: 1156896413

View in Genome Browser
Species Human (GRCh38)
Location 18:42251736-42251758
Sequence TTGTTGAATAGGAGCAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156896410_1156896413 5 Left 1156896410 18:42251708-42251730 CCTGATTGCTCAGACTTCAAATA No data
Right 1156896413 18:42251736-42251758 TTGTTGAATAGGAGCAATGAGGG No data
1156896409_1156896413 25 Left 1156896409 18:42251688-42251710 CCTGTTATTTCTTTCTCTTGCCT 0: 28
1: 2921
2: 5932
3: 10791
4: 5335
Right 1156896413 18:42251736-42251758 TTGTTGAATAGGAGCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156896413 Original CRISPR TTGTTGAATAGGAGCAATGA GGG Intergenic
No off target data available for this crispr