ID: 1156905149

View in Genome Browser
Species Human (GRCh38)
Location 18:42343669-42343691
Sequence TGGTCTTGTAAGACGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156905149_1156905152 -3 Left 1156905149 18:42343669-42343691 CCAGACTGCGTCTTACAAGACCA No data
Right 1156905152 18:42343689-42343711 CCATTCAATCAAAATTCTCAGGG No data
1156905149_1156905150 -4 Left 1156905149 18:42343669-42343691 CCAGACTGCGTCTTACAAGACCA No data
Right 1156905150 18:42343688-42343710 ACCATTCAATCAAAATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156905149 Original CRISPR TGGTCTTGTAAGACGCAGTC TGG (reversed) Intergenic