ID: 1156905150

View in Genome Browser
Species Human (GRCh38)
Location 18:42343688-42343710
Sequence ACCATTCAATCAAAATTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156905148_1156905150 0 Left 1156905148 18:42343665-42343687 CCTTCCAGACTGCGTCTTACAAG No data
Right 1156905150 18:42343688-42343710 ACCATTCAATCAAAATTCTCAGG No data
1156905147_1156905150 6 Left 1156905147 18:42343659-42343681 CCTTCGCCTTCCAGACTGCGTCT No data
Right 1156905150 18:42343688-42343710 ACCATTCAATCAAAATTCTCAGG No data
1156905149_1156905150 -4 Left 1156905149 18:42343669-42343691 CCAGACTGCGTCTTACAAGACCA No data
Right 1156905150 18:42343688-42343710 ACCATTCAATCAAAATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156905150 Original CRISPR ACCATTCAATCAAAATTCTC AGG Intergenic