ID: 1156905152

View in Genome Browser
Species Human (GRCh38)
Location 18:42343689-42343711
Sequence CCATTCAATCAAAATTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156905149_1156905152 -3 Left 1156905149 18:42343669-42343691 CCAGACTGCGTCTTACAAGACCA No data
Right 1156905152 18:42343689-42343711 CCATTCAATCAAAATTCTCAGGG No data
1156905148_1156905152 1 Left 1156905148 18:42343665-42343687 CCTTCCAGACTGCGTCTTACAAG No data
Right 1156905152 18:42343689-42343711 CCATTCAATCAAAATTCTCAGGG No data
1156905147_1156905152 7 Left 1156905147 18:42343659-42343681 CCTTCGCCTTCCAGACTGCGTCT No data
Right 1156905152 18:42343689-42343711 CCATTCAATCAAAATTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156905152 Original CRISPR CCATTCAATCAAAATTCTCA GGG Intergenic