ID: 1156911110

View in Genome Browser
Species Human (GRCh38)
Location 18:42412031-42412053
Sequence TACCCTTCCCCCAATGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156911110_1156911114 -1 Left 1156911110 18:42412031-42412053 CCACATCCATTGGGGGAAGGGTA No data
Right 1156911114 18:42412053-42412075 ATGCCTGGATCTATTTGGTTTGG No data
1156911110_1156911113 -6 Left 1156911110 18:42412031-42412053 CCACATCCATTGGGGGAAGGGTA No data
Right 1156911113 18:42412048-42412070 AGGGTATGCCTGGATCTATTTGG No data
1156911110_1156911116 7 Left 1156911110 18:42412031-42412053 CCACATCCATTGGGGGAAGGGTA No data
Right 1156911116 18:42412061-42412083 ATCTATTTGGTTTGGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156911110 Original CRISPR TACCCTTCCCCCAATGGATG TGG (reversed) Intergenic
No off target data available for this crispr