ID: 1156914765

View in Genome Browser
Species Human (GRCh38)
Location 18:42452739-42452761
Sequence TTGAATGTAGATAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156914763_1156914765 1 Left 1156914763 18:42452715-42452737 CCAGAGAAATGTGGTGGTATTAG No data
Right 1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156914765 Original CRISPR TTGAATGTAGATAAAGTGGA TGG Intergenic
No off target data available for this crispr