ID: 1156914922

View in Genome Browser
Species Human (GRCh38)
Location 18:42454430-42454452
Sequence TCTCTCAACTCCACATTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156914922_1156914929 15 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914929 18:42454468-42454490 ACAAGGGTGCTGGGAGTATATGG No data
1156914922_1156914930 16 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914930 18:42454469-42454491 CAAGGGTGCTGGGAGTATATGGG No data
1156914922_1156914932 28 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914932 18:42454481-42454503 GAGTATATGGGAGTATGAGGTGG No data
1156914922_1156914927 5 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG No data
1156914922_1156914931 25 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914931 18:42454478-42454500 TGGGAGTATATGGGAGTATGAGG No data
1156914922_1156914928 6 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914928 18:42454459-42454481 AGGATATGAACAAGGGTGCTGGG No data
1156914922_1156914925 -2 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914925 18:42454451-42454473 GAAGAGGCAGGATATGAACAAGG No data
1156914922_1156914926 -1 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914926 18:42454452-42454474 AAGAGGCAGGATATGAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156914922 Original CRISPR TCTCTCAACTCCACATTGCT TGG (reversed) Intergenic
No off target data available for this crispr