ID: 1156914927

View in Genome Browser
Species Human (GRCh38)
Location 18:42454458-42454480
Sequence CAGGATATGAACAAGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156914922_1156914927 5 Left 1156914922 18:42454430-42454452 CCAAGCAATGTGGAGTTGAGAGA No data
Right 1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156914927 Original CRISPR CAGGATATGAACAAGGGTGC TGG Intergenic
No off target data available for this crispr