ID: 1156915868

View in Genome Browser
Species Human (GRCh38)
Location 18:42464126-42464148
Sequence GCTCCACATTAAGAAGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156915868_1156915876 9 Left 1156915868 18:42464126-42464148 CCGTCCCCTTCTTAATGTGGAGC No data
Right 1156915876 18:42464158-42464180 CCACATTACCTTCTTTTCAATGG 0: 639
1: 275
2: 57
3: 50
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156915868 Original CRISPR GCTCCACATTAAGAAGGGGA CGG (reversed) Intergenic
No off target data available for this crispr