ID: 1156918432

View in Genome Browser
Species Human (GRCh38)
Location 18:42488977-42488999
Sequence CAATAGGGCTGGAGAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156918432_1156918440 27 Left 1156918432 18:42488977-42488999 CCTACTCCTCTCCAGCCCTATTG No data
Right 1156918440 18:42489027-42489049 AGACATGTCTGAGCTACTGCTGG No data
1156918432_1156918442 29 Left 1156918432 18:42488977-42488999 CCTACTCCTCTCCAGCCCTATTG No data
Right 1156918442 18:42489029-42489051 ACATGTCTGAGCTACTGCTGGGG No data
1156918432_1156918441 28 Left 1156918432 18:42488977-42488999 CCTACTCCTCTCCAGCCCTATTG No data
Right 1156918441 18:42489028-42489050 GACATGTCTGAGCTACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156918432 Original CRISPR CAATAGGGCTGGAGAGGAGT AGG (reversed) Intergenic
No off target data available for this crispr