ID: 1156930225

View in Genome Browser
Species Human (GRCh38)
Location 18:42632811-42632833
Sequence TAGGGTATACAGATGTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156930220_1156930225 14 Left 1156930220 18:42632774-42632796 CCTTTGGTTTGAAAGCCTCTGAC No data
Right 1156930225 18:42632811-42632833 TAGGGTATACAGATGTGGCTTGG No data
1156930221_1156930225 -1 Left 1156930221 18:42632789-42632811 CCTCTGACACTATTAATAAAGAT No data
Right 1156930225 18:42632811-42632833 TAGGGTATACAGATGTGGCTTGG No data
1156930219_1156930225 15 Left 1156930219 18:42632773-42632795 CCCTTTGGTTTGAAAGCCTCTGA No data
Right 1156930225 18:42632811-42632833 TAGGGTATACAGATGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156930225 Original CRISPR TAGGGTATACAGATGTGGCT TGG Intergenic
No off target data available for this crispr