ID: 1156930225 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:42632811-42632833 |
Sequence | TAGGGTATACAGATGTGGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1156930220_1156930225 | 14 | Left | 1156930220 | 18:42632774-42632796 | CCTTTGGTTTGAAAGCCTCTGAC | No data | ||
Right | 1156930225 | 18:42632811-42632833 | TAGGGTATACAGATGTGGCTTGG | No data | ||||
1156930221_1156930225 | -1 | Left | 1156930221 | 18:42632789-42632811 | CCTCTGACACTATTAATAAAGAT | No data | ||
Right | 1156930225 | 18:42632811-42632833 | TAGGGTATACAGATGTGGCTTGG | No data | ||||
1156930219_1156930225 | 15 | Left | 1156930219 | 18:42632773-42632795 | CCCTTTGGTTTGAAAGCCTCTGA | No data | ||
Right | 1156930225 | 18:42632811-42632833 | TAGGGTATACAGATGTGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1156930225 | Original CRISPR | TAGGGTATACAGATGTGGCT TGG | Intergenic | ||
No off target data available for this crispr |