ID: 1156933601

View in Genome Browser
Species Human (GRCh38)
Location 18:42675641-42675663
Sequence GATCCTTCCCCTAGTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156933600_1156933601 -6 Left 1156933600 18:42675624-42675646 CCTGGCTAAGACAAAGTGATCCT No data
Right 1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG No data
1156933596_1156933601 25 Left 1156933596 18:42675593-42675615 CCAGAGACTCCTGCATGGTGTCT No data
Right 1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG No data
1156933598_1156933601 16 Left 1156933598 18:42675602-42675624 CCTGCATGGTGTCTTCTAGGCAC No data
Right 1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156933601 Original CRISPR GATCCTTCCCCTAGTGTGTG TGG Intergenic
No off target data available for this crispr