ID: 1156944754

View in Genome Browser
Species Human (GRCh38)
Location 18:42815033-42815055
Sequence CTGTGTCAGAGAAACGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 449}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156944754_1156944756 -5 Left 1156944754 18:42815033-42815055 CCTAGACCGTTTCTCTGACACAG 0: 1
1: 0
2: 4
3: 65
4: 449
Right 1156944756 18:42815051-42815073 CACAGCCTACCCAAAATAGAAGG 0: 1
1: 0
2: 12
3: 318
4: 576
1156944754_1156944761 23 Left 1156944754 18:42815033-42815055 CCTAGACCGTTTCTCTGACACAG 0: 1
1: 0
2: 4
3: 65
4: 449
Right 1156944761 18:42815079-42815101 GAAAACCAACTCTAGTAATATGG 0: 1
1: 4
2: 9
3: 24
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156944754 Original CRISPR CTGTGTCAGAGAAACGGTCT AGG (reversed) Intronic
900860156 1:5223186-5223208 CTGTGGCAGAGGAAGGGTCCAGG + Intergenic
902371163 1:16007816-16007838 CTGTGTCAGAGAAACAACATGGG + Exonic
902969512 1:20037183-20037205 CTATGTCAGAGGAAAGATCTGGG + Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
906877078 1:49551425-49551447 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
907038175 1:51235278-51235300 CTGTGACAGAGAAAAGCTCAGGG + Intergenic
907349234 1:53812119-53812141 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
908803666 1:67907530-67907552 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
909514558 1:76492550-76492572 CTGTGCCATAGAAAGTGTCTTGG + Intronic
911317958 1:96377153-96377175 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
911562131 1:99418601-99418623 CTGTGTCAGAGAGAAGATCTGGG - Intergenic
911678819 1:100691173-100691195 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
911743372 1:101411615-101411637 CTATGTCAGAGAGAAGATCTGGG - Intergenic
912612353 1:111061506-111061528 CTATGTCAGAGGAAAGATCTGGG + Intergenic
913036432 1:114970538-114970560 CTATGTCAGAGGAAAGATCTGGG + Intronic
913060187 1:115197462-115197484 CTTTGTCACAGACACAGTCTGGG - Intergenic
913143217 1:115962427-115962449 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
913339648 1:117746477-117746499 CTCTGTCAGAGGGAAGGTCTTGG + Intergenic
913972957 1:143430018-143430040 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
914067341 1:144255625-144255647 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
914111812 1:144710729-144710751 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
915999827 1:160605299-160605321 TTATGTCAGAGGAAAGGTCTAGG + Intergenic
916263849 1:162869719-162869741 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
916277769 1:163013737-163013759 CTATGTCAGAGAGAAGATCTGGG + Intergenic
917057796 1:171003371-171003393 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
917319069 1:173759735-173759757 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
917461666 1:175235427-175235449 CTGTGTCAGAAGGAAGGTCTAGG - Intergenic
918781168 1:188702313-188702335 TTATGTCAGAGAAAGGGTGTGGG + Intergenic
918819649 1:189236521-189236543 CTATGTCAGAGAGAAGATCTGGG + Intergenic
918873585 1:190009055-190009077 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
919277988 1:195445519-195445541 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
919549406 1:198966036-198966058 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
920726882 1:208444868-208444890 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
921762788 1:218936747-218936769 CTGTGTCAGAGGAAATATCTGGG + Intergenic
922395920 1:225201493-225201515 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
922673293 1:227531826-227531848 CTCTGTCAAACAAAAGGTCTAGG + Intergenic
922680944 1:227595357-227595379 CTGTGTAAGGGAACTGGTCTGGG + Intronic
923378905 1:233394877-233394899 CTGTTTCAGAGAAAAAGACTTGG - Intergenic
923648321 1:235846384-235846406 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
923661715 1:235962763-235962785 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
923808565 1:237287940-237287962 CTCTGTCAGAGGGAGGGTCTAGG + Intronic
924321323 1:242854280-242854302 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
924384108 1:243487174-243487196 CTGTGTCAGAGGGTCGGCCTAGG + Intronic
1062760900 10:17795-17817 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1063284071 10:4663606-4663628 GTGTGTCAAAGCAACGGGCTAGG + Intergenic
1066747184 10:38612284-38612306 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1068096525 10:52498913-52498935 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1068480861 10:57586286-57586308 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1069218386 10:65851801-65851823 CTGTATTAGAGAGATGGTCTGGG + Intergenic
1069402184 10:68061047-68061069 CTGTGAAAGGGAAACGGTGTGGG - Intronic
1071024101 10:81092360-81092382 CTCTGTCAGAGGAAAGATCTAGG + Intergenic
1071910730 10:90229864-90229886 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1073191980 10:101658058-101658080 CTGATTCAGAGAAACTGTCATGG + Intronic
1073907437 10:108299111-108299133 CTGTTTTAGAGAAGGGGTCTGGG + Intergenic
1073960341 10:108919453-108919475 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1073995219 10:109307932-109307954 CTGTGTAAGAGAAACTCTCATGG + Intergenic
1074985729 10:118658164-118658186 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1075946893 10:126440902-126440924 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1075982664 10:126755012-126755034 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1077096137 11:799922-799944 CTGCGTCAGAAAGCCGGTCTCGG + Exonic
1077637497 11:3853826-3853848 CTGGCTCAGAGAATAGGTCTAGG + Intergenic
1078164985 11:8874918-8874940 CTGTCTCAAAGAAAAGGTATTGG + Intronic
1078288684 11:9983939-9983961 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1079791630 11:24747175-24747197 CTCTGTCATAGAAAAGGTCCAGG + Intronic
1079856551 11:25612154-25612176 CTATGTCAGAGGGAGGGTCTGGG + Intergenic
1080152940 11:29075724-29075746 CTGTGTCAGAGGGAAGGTCTAGG + Intergenic
1080324206 11:31050843-31050865 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1080891143 11:36410121-36410143 CTGTGGCTGAGAAACAGACTTGG + Intronic
1082934930 11:58646585-58646607 CTGTGTCAGAGGAATGCTATGGG + Intronic
1083491268 11:63016415-63016437 CTGTGTCAGAGACACAGACACGG - Intergenic
1085917243 11:80904001-80904023 CTCTGTCAGAGGCAAGGTCTAGG - Intergenic
1086300595 11:85423070-85423092 CTGTGTCAGAGGGAAGGTCTAGG + Intronic
1087817464 11:102675638-102675660 CTATGTCAGATAAAAGATCTGGG + Intergenic
1088179564 11:107093243-107093265 CTGTGTCAGCGGGAAGGTCTAGG - Intergenic
1088206508 11:107398039-107398061 CTGTGTCAAAGGGAAGGTCTAGG - Intronic
1090559439 11:127914966-127914988 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1090682729 11:129078319-129078341 CTATGTCAGAGGAAAGATCTTGG - Intronic
1090757395 11:129804359-129804381 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1091210438 11:133853938-133853960 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1092125627 12:6073287-6073309 GTGTGTCAGGGAACCGATCTGGG - Intronic
1092303794 12:7279192-7279214 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1092677771 12:10941850-10941872 CTCTATCAGAGAAAAGATCTAGG + Intronic
1092742981 12:11648725-11648747 CGGTTTCAGAGAAGCGGTCCTGG + Intergenic
1093001955 12:14007243-14007265 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1093010613 12:14102524-14102546 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1093104973 12:15075258-15075280 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1093409180 12:18844722-18844744 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1093488641 12:19680806-19680828 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1093995045 12:25631660-25631682 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1094447270 12:30545653-30545675 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1094501398 12:31023872-31023894 CTGTGTCAGAGGGAAAGTCTAGG - Intergenic
1094667222 12:32532741-32532763 CTGTGGCAGAGAATCTGTTTAGG - Intronic
1094721933 12:33074807-33074829 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1094808633 12:34115498-34115520 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1094809893 12:34126597-34126619 GTGTGTGAAAGAAACGGTCTTGG - Intergenic
1096888505 12:54743123-54743145 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1097160252 12:57041322-57041344 CTGAGACGGAGAAACAGTCTTGG - Intronic
1097603904 12:61729852-61729874 CTATGTCAGAGGAAAGATCTGGG + Intronic
1097760641 12:63460039-63460061 CTCTGTCAGAGGGAAGGTCTGGG - Intergenic
1098960841 12:76738624-76738646 CTCTGTCAGAGAGAAGATCTAGG + Intergenic
1099687349 12:85907528-85907550 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1100203505 12:92324879-92324901 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1100706409 12:97204368-97204390 CTCTGTCAGAAAGAAGGTCTCGG - Intergenic
1103761016 12:123250487-123250509 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1105598769 13:21866584-21866606 CTATGTCAGAGGAAAGATCTGGG + Intergenic
1105611753 13:21974876-21974898 CTGTCTCAGGGTAACGGTGTGGG + Intergenic
1105908346 13:24835683-24835705 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1106717799 13:32409091-32409113 CTGTGGCGTAGAAACAGTCTGGG - Intronic
1107184915 13:37506356-37506378 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1107666147 13:42693292-42693314 CTCTGTCAGAGGGAGGGTCTAGG + Intergenic
1107755907 13:43622375-43622397 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1108633117 13:52305985-52306007 TTGTGTCAGAAAAATAGTCTAGG - Intergenic
1108653574 13:52506575-52506597 TTGTGTCAGAAAAATAGTCTAGG + Intergenic
1108825635 13:54408789-54408811 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
1109213492 13:59562506-59562528 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1109484671 13:63002576-63002598 CTATGTCAGAGAGATGTTCTGGG - Intergenic
1109508324 13:63336394-63336416 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1109975773 13:69829452-69829474 CTATGTCAGAGGAAAGATCTGGG - Intronic
1110661122 13:78060427-78060449 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1111022583 13:82472463-82472485 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1112035264 13:95491794-95491816 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1112087079 13:96042377-96042399 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1112945406 13:104920841-104920863 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1113269852 13:108661913-108661935 CTCTGTCAGAGGAAAGGTCTAGG + Intronic
1114030700 14:18577516-18577538 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1115350553 14:32390478-32390500 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1115527145 14:34292870-34292892 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1115938052 14:38577667-38577689 CTATGTCAGAGGAAAGATCTGGG + Intergenic
1115969901 14:38933138-38933160 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1116044776 14:39731586-39731608 CTATGTCAGAGAAAAGATTTGGG + Intergenic
1116088915 14:40278845-40278867 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1116668934 14:47816831-47816853 CTATGTCAGAGGAAAGATCTAGG + Intergenic
1117112854 14:52476190-52476212 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1117510697 14:56448267-56448289 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1117615061 14:57526615-57526637 CTCTGTCAGAGGAAAGATCTGGG + Intergenic
1117639920 14:57786775-57786797 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1118165680 14:63333134-63333156 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1118820943 14:69345512-69345534 CTCTGTCAGTGAAACAATCTGGG - Intronic
1119098554 14:71856938-71856960 CTCTGTCAGAGAGAAGGTTTAGG - Intergenic
1119499367 14:75110601-75110623 CTGTCTCTGAGAAATGGTCCAGG + Intronic
1119552745 14:75527054-75527076 CTGTGTGACAGAGACGTTCTTGG + Intronic
1120545689 14:85808808-85808830 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1120774840 14:88422216-88422238 CTGTGTCAGCAAAGAGGTCTGGG + Intronic
1121459952 14:94066846-94066868 CTGTTTCAGAGGGAAGGTCTAGG - Intronic
1122692365 14:103537461-103537483 CTGAGTCAGAGCCAGGGTCTGGG - Intergenic
1124380817 15:29163172-29163194 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1124386999 15:29217875-29217897 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1124674043 15:31668779-31668801 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1125269318 15:37921098-37921120 CTCTGTCAGAGGGATGGTCTAGG + Intergenic
1126474342 15:49050627-49050649 CTATGTGAGAGAAACTTTCTGGG - Intergenic
1126572808 15:50169540-50169562 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1127194554 15:56569405-56569427 CTGTGTTAGAGGGAAGGTCTAGG - Intergenic
1128238821 15:66085687-66085709 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1128415109 15:67437418-67437440 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1129918431 15:79295609-79295631 CTGTGTCAGGGGACGGGTCTGGG - Exonic
1130342414 15:83011036-83011058 CTGAGTCTGAGAAACGGACTGGG + Intronic
1131326754 15:91455649-91455671 CTGTGTCAGAGGGAAGGTCTAGG + Intergenic
1132210195 15:100016493-100016515 CTCTGTCAAAGGAAAGGTCTAGG + Intronic
1132459228 16:42114-42136 GTGTGTGAAAGAGACGGTCTCGG + Intergenic
1133953099 16:10414749-10414771 CTCTGTCAGAGGAAAGGTTTAGG + Intronic
1136735882 16:32467360-32467382 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1140710069 16:77669485-77669507 CTGTGTCTGGGAAACAGGCTTGG - Intergenic
1141701931 16:85646608-85646630 CTGTGTCAGGGAAGGGGGCTTGG + Intronic
1203017193 16_KI270728v1_random:362214-362236 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1203035528 16_KI270728v1_random:635372-635394 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1144024233 17:11263414-11263436 CTGTGAAAGAGAAACTATCTCGG + Exonic
1144139580 17:12336012-12336034 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1146751363 17:35384378-35384400 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1151298214 17:73201458-73201480 CTGTGTGGGAGAAACGTCCTTGG - Exonic
1152887309 17:82860037-82860059 CTGTGCCAGGGACACTGTCTTGG + Intronic
1152953807 18:18149-18171 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1153164368 18:2244964-2244986 TTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1153168888 18:2292947-2292969 CTGTGTCAGAGGGAAGGTCTAGG + Intergenic
1153400571 18:4679618-4679640 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1153965842 18:10181574-10181596 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1156944754 18:42815033-42815055 CTGTGTCAGAGAAACGGTCTAGG - Intronic
1157551055 18:48582198-48582220 CAGTGTCAGAGGAAGGGTCCTGG + Intronic
1158002707 18:52637180-52637202 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1158348675 18:56541753-56541775 CTGCATCAGAGAAGGGGTCTGGG - Intergenic
1158829852 18:61264676-61264698 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1160219660 18:76965516-76965538 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1164472950 19:28551031-28551053 CTATGTCAGAGAAACATTTTTGG - Intergenic
1165286447 19:34846623-34846645 GTGTGTGAGAGAAAGGGTCCAGG - Intergenic
1165987612 19:39784390-39784412 CTCTGTCAGAGGGACGGTCTAGG + Intronic
1166262838 19:41653429-41653451 CTATGTCAGAGGAAAGATCTGGG - Intronic
1166604161 19:44126168-44126190 CTCTGTCAGAGGTAAGGTCTAGG + Intronic
925127386 2:1469335-1469357 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
926560273 2:14409013-14409035 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
926915912 2:17892563-17892585 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
929045568 2:37785659-37785681 CTGTGTCTGAGAGAGGGTCTTGG - Intergenic
930337245 2:50064526-50064548 CTGTGTACAAGAAACAGTCTTGG + Intronic
931993112 2:67810334-67810356 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
932100565 2:68896061-68896083 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
932954553 2:76336791-76336813 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
934177653 2:89590974-89590996 CTCTGTCAGAGGAAAGTTCTAGG + Intergenic
934187049 2:89756472-89756494 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
934287952 2:91665275-91665297 CTCTGTCAGAGGAAAGTTCTAGG + Intergenic
934309584 2:91851453-91851475 CACTGTCAGAGGAAAGGTCTAGG - Intergenic
936164540 2:110108047-110108069 CTCTGTCAGAGTGAAGGTCTAGG - Intronic
936555004 2:113488378-113488400 CTCTGTCAGAGAGAATGTCTAGG - Intronic
937251728 2:120528171-120528193 CTGAGACAGAAGAACGGTCTGGG + Intergenic
937521883 2:122721505-122721527 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
937781889 2:125848307-125848329 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
938037992 2:128052651-128052673 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
938497510 2:131808250-131808272 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
939149605 2:138457003-138457025 CTATGTCAGAGGAAAGATCTGGG - Intergenic
939240175 2:139548132-139548154 CTCTGTCAGAGAGAAGGTCTAGG + Intergenic
939868857 2:147505360-147505382 CTCTGTAAGAGAACCTGTCTGGG + Intergenic
940034625 2:149301192-149301214 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
940217618 2:151316365-151316387 CTATGTCAGAGGAAAGGTCTAGG - Intergenic
940762482 2:157752320-157752342 CTATGTCAGAGGGAAGGTCTGGG - Intronic
940969410 2:159878907-159878929 CTGTGTCAGACAAAAAGTATGGG + Intronic
941453129 2:165683671-165683693 CTGTGTTAGAACAACTGTCTTGG + Exonic
941593760 2:167451323-167451345 CTATGTCAGAGGGAAGGTCTAGG + Intergenic
941631532 2:167890586-167890608 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
942154642 2:173115542-173115564 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
942470021 2:176250623-176250645 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
943129773 2:183840546-183840568 CTCTGTCAGAGAGAAGGTCTAGG - Intergenic
943199313 2:184798861-184798883 CTATGTCAGAGGGAAGGTCTAGG + Intronic
943891205 2:193289698-193289720 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
943937199 2:193934954-193934976 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
945132027 2:206583988-206584010 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
945482496 2:210360323-210360345 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
945825788 2:214718288-214718310 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
946727880 2:222679538-222679560 CTGTGGAAGAGAAATGTTCTTGG - Intronic
947456987 2:230264602-230264624 CTCTGTCAGAGGGAGGGTCTAGG + Intronic
1169114097 20:3051744-3051766 CTGAGGGAGAGAAATGGTCTGGG + Intergenic
1169401410 20:5283501-5283523 CTCTGTCAGAAAGAGGGTCTAGG - Intergenic
1170245665 20:14219656-14219678 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1170375788 20:15699206-15699228 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1170642075 20:18163279-18163301 CAGTGTCAGAGACACCGTCATGG - Intronic
1170703054 20:18721658-18721680 CTGTGTCTGTAAAACCGTCTGGG + Intronic
1170724704 20:18916039-18916061 CTGAGTCAGAGAAAAGGAGTGGG + Intergenic
1171165684 20:22968056-22968078 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1171259271 20:23717626-23717648 CTGTGTCAGAGGGAAGATCTGGG + Intergenic
1171280590 20:23893317-23893339 CTGTGTCAGACAGAAGATCTGGG + Intergenic
1173762312 20:45573758-45573780 CTGTCTCTGATAAATGGTCTTGG - Intronic
1175069165 20:56317085-56317107 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1175127472 20:56763269-56763291 CTGTGTTGGAGAAACGCTTTGGG + Intergenic
1177140612 21:17353629-17353651 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1177174348 21:17688662-17688684 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1177847430 21:26306549-26306571 CTCTGTCACAGAGAAGGTCTAGG - Intergenic
1177995258 21:28089431-28089453 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1178801773 21:35801927-35801949 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1178959133 21:37047874-37047896 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1179084109 21:38202611-38202633 CTCTGTCAGAGGGAAGGTCTGGG + Intronic
1179443430 21:41412061-41412083 CTATGTCAGAGGAAAGATCTGGG - Intergenic
1180454814 22:15504572-15504594 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1180536680 22:16398592-16398614 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG + Intergenic
1181371130 22:22417640-22417662 CTCTGTCAGAGGAGAGGTCTAGG - Intergenic
1181687832 22:24541789-24541811 CTTTTTCAGAGAAAGGGACTTGG - Intronic
1183048278 22:35239882-35239904 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
949814352 3:8041656-8041678 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
950592316 3:13947333-13947355 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
950603460 3:14057269-14057291 CTCTGTCAGAGGAAAGGTCTAGG + Intronic
951764143 3:26178583-26178605 CTCTGTCAGAGGGAGGGTCTAGG + Intergenic
951967216 3:28399791-28399813 CTCTGTCAGACAGAAGGTCTAGG - Intronic
952122804 3:30264620-30264642 CTGTGTCAGAGGAAAGATCTGGG - Intergenic
952689760 3:36191589-36191611 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
953866505 3:46587586-46587608 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
954012266 3:47651916-47651938 CTGTGCCAGAGAAGCTTTCTTGG - Intronic
955450657 3:59063966-59063988 CTATGTCAGAGGAAAGATCTGGG + Intergenic
957273261 3:78058332-78058354 CTGTGTCTGAAAAACTATCTAGG - Intergenic
957971792 3:87391263-87391285 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
958262898 3:91403608-91403630 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
958480698 3:94642882-94642904 CTCTGTCAGGGAGAAGGTCTAGG + Intergenic
958505701 3:94974149-94974171 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
958770762 3:98422483-98422505 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
959039569 3:101405443-101405465 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
959047056 3:101485621-101485643 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
959275136 3:104269109-104269131 CTCTGTCAGAGGAAAGGTGTAGG + Intergenic
959899145 3:111639991-111640013 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
960512763 3:118571122-118571144 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
960516632 3:118608840-118608862 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
962034534 3:131637052-131637074 CTATGTCAGAGGAAAGATCTGGG - Intronic
962065926 3:131980821-131980843 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
962504856 3:136036347-136036369 CTCTGTCAGAGGAAAGGTCTAGG + Intronic
962878228 3:139552341-139552363 CTGGATCAGAGAAATGGTATGGG + Intergenic
963687834 3:148460594-148460616 CTATGTCAGAGGGAAGGTCTGGG + Intergenic
964075757 3:152689289-152689311 CTATGTCAGAGAAAAGGTCTGGG - Intergenic
964189079 3:153980923-153980945 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
964518002 3:157533639-157533661 GTGTGTCAGAGGAGAGGTCTGGG - Intergenic
964601157 3:158503016-158503038 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
965132736 3:164722950-164722972 CTATGTCAGAGGAAGGATCTGGG + Intergenic
965216795 3:165874354-165874376 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
965321796 3:167260958-167260980 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
965874292 3:173298915-173298937 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
966117608 3:176484647-176484669 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
967162995 3:186755828-186755850 CTTTTTCAGAGATAGGGTCTCGG - Intergenic
967559039 3:190896313-190896335 CTCTATCAGAGAGAAGGTCTAGG - Intergenic
968125570 3:196157532-196157554 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
968720627 4:2200726-2200748 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
970215726 4:13758272-13758294 CTATGTCAGAGGAAAGATCTAGG + Intergenic
970549223 4:17163052-17163074 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
970658537 4:18259667-18259689 CTCTGTCAGAGGGACAGTCTAGG + Intergenic
970996184 4:22269482-22269504 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
971854822 4:32029763-32029785 CTTTGTTAGAGACAGGGTCTTGG + Intergenic
973179487 4:47251076-47251098 CTGTGTGAGAGGGAAGGTCTAGG + Intronic
974951055 4:68583113-68583135 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
975034056 4:69659054-69659076 CTATGTCAGAGGGAAGGTCTAGG - Intergenic
975365124 4:73520410-73520432 CTATGTCAGAGGAAAGATCTGGG + Intergenic
975517341 4:75260850-75260872 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
975680295 4:76868888-76868910 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
975788629 4:77922907-77922929 CTGAATCAGAGAAAAGGGCTGGG + Intronic
976008844 4:80462522-80462544 CTGTGTCAGAGAAACATATTGGG - Intronic
976465056 4:85357870-85357892 CTGTGTCAGAGGGAAGATCTGGG + Intergenic
976856574 4:89610788-89610810 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
977156781 4:93583737-93583759 ATGTGTCTGAGGAACGGCCTTGG - Intronic
977510558 4:97956838-97956860 CTCTGTCAGAGGAAAGGTGTAGG - Intronic
977733304 4:100380499-100380521 CTGTGTCAGAGGGAAGGTCTGGG - Intergenic
977905797 4:102476285-102476307 CTGTGTCAGAGGAAATATCTGGG - Intergenic
978858256 4:113418082-113418104 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
979020441 4:115489765-115489787 CTGTGTCAGAGGGAAGATCTGGG - Intergenic
979340731 4:119520450-119520472 CTGTTTCATAGAAAGGGTTTTGG - Intronic
979704924 4:123709737-123709759 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
980087120 4:128403233-128403255 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
980153131 4:129072931-129072953 CTCTATCAGAGGAAAGGTCTAGG + Intronic
980523727 4:133962143-133962165 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
980644982 4:135632596-135632618 CTATGTCAGAGAAAAGATCTGGG + Intergenic
981346731 4:143684517-143684539 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
981461199 4:145014948-145014970 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
981760700 4:148192115-148192137 CTCTGTCAGAGGGACGGTCTAGG + Intronic
982119517 4:152128495-152128517 CTCTGTCAGAGGTAAGGTCTAGG + Intergenic
982189848 4:152843046-152843068 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
982218678 4:153106483-153106505 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
982218687 4:153106540-153106562 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
982312063 4:153996805-153996827 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
982630649 4:157824963-157824985 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
982680055 4:158418527-158418549 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
982696521 4:158608444-158608466 CTTTGTCAGAGACAGGGTCTTGG - Intronic
983175609 4:164585134-164585156 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
983449879 4:167896018-167896040 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
983729765 4:170978809-170978831 CTGTGTCAGAAGGAAGGTCTGGG + Intergenic
983845492 4:172513546-172513568 CTATGTCAGAGGAAAGATCTGGG + Intronic
984266612 4:177504891-177504913 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
984527462 4:180874912-180874934 CTCTGTCAGAGGGAAGGTCTGGG + Intergenic
984721777 4:182978932-182978954 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
985288651 4:188363227-188363249 CTGTGTCAGAGGGAAGGTCTGGG - Intergenic
989027383 5:37083290-37083312 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
990233419 5:53739851-53739873 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
990712747 5:58603934-58603956 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
990899653 5:60736997-60737019 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
991117471 5:62970571-62970593 CTCTGTCAGAGGGAAGGTCTGGG - Intergenic
991619983 5:68534899-68534921 CTGTCTCTAAGAAAAGGTCTGGG - Intergenic
991623084 5:68566212-68566234 CTATGTCAGAGGAAAGATCTGGG - Intergenic
991923964 5:71684937-71684959 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
992520243 5:77543166-77543188 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
993250247 5:85512752-85512774 CTCTCTCAGAGGAAAGGTCTAGG + Intergenic
993746838 5:91610600-91610622 CTGTGTCAGATAAACTATATAGG - Intergenic
994051218 5:95365127-95365149 CTTTGTCAGAGGGAAGGTCTAGG + Intergenic
994778069 5:104060941-104060963 CTGTGTCAGAGGAAAGACCTGGG + Intergenic
994875396 5:105414506-105414528 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
995421009 5:111966936-111966958 CTGTGCCCAAGAAAGGGTCTAGG + Intronic
995449245 5:112282109-112282131 ATGTGTCAGTGAAATGCTCTTGG + Intronic
995694513 5:114864991-114865013 CTCTGTCAGAGGAAGGGTCTAGG + Intergenic
995817905 5:116192173-116192195 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
996145864 5:119975367-119975389 CTGTGTCATAGAAAACGTCATGG - Intergenic
996288859 5:121828486-121828508 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
996504705 5:124256676-124256698 CTCTGTCAGAGGCAAGGTCTAGG + Intergenic
998179432 5:139926096-139926118 CTGTGTCAGAGGAAGGCCCTAGG - Intronic
999086194 5:148892414-148892436 CTGTGTCAGAGGGAAGATCTGGG - Intergenic
999337613 5:150735670-150735692 CTATGTCAGAGGAAAGATCTGGG - Intronic
999677182 5:154015634-154015656 CTGTGTCAGAGGAAAGGTCTAGG - Intronic
999913321 5:156230309-156230331 CTCTGTCAGAGGAAAGGTTTAGG + Intronic
1000757822 5:165183613-165183635 CTCTGTCAGAAAGAAGGTCTAGG + Intergenic
1003450979 6:6230951-6230973 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1003861408 6:10325464-10325486 CTGTGATAGAAAAACAGTCTGGG - Intergenic
1003930389 6:10919203-10919225 CTCTGTCAGAGGGAAGGTCTGGG + Intronic
1005072589 6:21875184-21875206 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1005305657 6:24511960-24511982 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1006365799 6:33614405-33614427 CTGAGTCAGGGAGAAGGTCTGGG + Intergenic
1007317726 6:41002902-41002924 CTGTGTCAGAGGACTGTTCTCGG + Intergenic
1007892748 6:45310790-45310812 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1008256225 6:49303355-49303377 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1008305410 6:49892949-49892971 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1008992515 6:57619278-57619300 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1009181133 6:60518391-60518413 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1009453265 6:63825755-63825777 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1009493769 6:64325426-64325448 CTCTGTCAGAGGAAAGGTCTAGG - Intronic
1009644419 6:66378822-66378844 CTATGTCAGAGGAAAGATCTGGG - Intergenic
1009798596 6:68503457-68503479 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1009867005 6:69409748-69409770 CTATGTCAGAGGAAAGATCTGGG - Intergenic
1009968926 6:70605508-70605530 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1010045381 6:71436886-71436908 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
1010076274 6:71802840-71802862 CTGTGTCAGAAGGAAGGTCTAGG + Intergenic
1010165013 6:72905505-72905527 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1010584751 6:77643927-77643949 CTGTGTCAAGGAAATGATCTGGG - Intergenic
1010679420 6:78781802-78781824 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1011328984 6:86183319-86183341 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1012551543 6:100468003-100468025 CTGTGCCAGAGCAAGGGTCGGGG - Intergenic
1012581258 6:100872898-100872920 GTCTGTCAGAGAGAAGGTCTAGG - Intronic
1012922761 6:105235963-105235985 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1013221227 6:108079778-108079800 CTGTGTCAGAGGGAAGGTCTAGG + Intronic
1013856760 6:114581831-114581853 CTATGTCAGAGAAAAAATCTGGG - Intergenic
1014285055 6:119487590-119487612 CTATGTCAGAGGGAAGGTCTAGG - Intergenic
1014304744 6:119726949-119726971 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1014603991 6:123449082-123449104 CTCTGTCAGAGTGAAGGTCTAGG - Intronic
1014738859 6:125124976-125124998 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1015222236 6:130817274-130817296 CTTTGTCAGAGGGAAGGTCTAGG - Intergenic
1015663217 6:135599872-135599894 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1015877883 6:137842502-137842524 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1016910033 6:149189918-149189940 CTGTGTCAGAGAAAAGATCTGGG + Intergenic
1019484349 7:1282278-1282300 CTGTCTCAAACAAACGGGCTGGG - Intergenic
1020634991 7:10685558-10685580 CTCTGTCAGAGGGAAGGTCTTGG - Intergenic
1020860878 7:13490102-13490124 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1021340146 7:19455207-19455229 CTGTGTCAGAGGGAAGATCTGGG + Intergenic
1023701351 7:42894131-42894153 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1024917137 7:54514694-54514716 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1025794733 7:64729093-64729115 CTATGTCAGAGGGAAGGTCTAGG + Intergenic
1027821369 7:83049565-83049587 CTGTGTGACAGCAAGGGTCTAGG + Intronic
1028182862 7:87747102-87747124 CTCTGTCAGAGGGAAGGTCTAGG + Intronic
1028782971 7:94757933-94757955 CTATGTCAGAGGAAAGATCTGGG - Intergenic
1028889790 7:95974181-95974203 CTGTGTCAGACAAATGCTATGGG - Intronic
1028993489 7:97075421-97075443 CTCTGTCAGAGAGAAGGTCTAGG + Intergenic
1029051982 7:97699535-97699557 CTGTGTCAGACTGAAGGTCTTGG - Intergenic
1030390355 7:108920476-108920498 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1031138956 7:117919762-117919784 CTGTGTCAGAGTGAAGGTCCAGG - Intergenic
1031655375 7:124348953-124348975 CTATGTCAGAGAAAAGATCTGGG + Intergenic
1032289361 7:130574555-130574577 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1032388068 7:131538255-131538277 CTCGGTCAGAGAATGGGTCTGGG - Intronic
1032605170 7:133343149-133343171 CTATGTCAGAGAAAGGATCTGGG + Intronic
1033026929 7:137782992-137783014 CTATGTCAGAGGAAAGATCTGGG - Intronic
1033189306 7:139262398-139262420 CTATTTAAGAGAAAAGGTCTAGG - Intronic
1033816616 7:145082046-145082068 CTATGTCAGAGGAAAGATCTGGG + Intergenic
1035113366 7:156503613-156503635 CTGTGTTTGAGAAAGGGACTTGG - Intergenic
1035151314 7:156874807-156874829 CTATGTCAGAGGGAAGGTCTAGG - Intronic
1035175377 7:157046378-157046400 CTTTGTAAGAGAAACGGGCCAGG + Intergenic
1035972571 8:4266292-4266314 CTATGTAAGAGAAACTGTCCAGG + Intronic
1037211902 8:16398932-16398954 ATGTGTCAGAGTCAGGGTCTAGG - Intronic
1038367117 8:26947875-26947897 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1039083199 8:33754800-33754822 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1039123677 8:34176196-34176218 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1039641560 8:39228191-39228213 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1040635580 8:49269925-49269947 CTGTGTCAGGGGGAAGGTCTAGG + Intergenic
1040800338 8:51332339-51332361 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1041120273 8:54579554-54579576 CTGTGTCAGGGAGAAGTTCTGGG + Intergenic
1041150424 8:54926474-54926496 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
1041227861 8:55717714-55717736 CTCTGTCAGAGAGAAGGTCTAGG - Intronic
1041570451 8:59332544-59332566 CTCTGTCAGAGCAGAGGTCTAGG + Intergenic
1041637204 8:60157055-60157077 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1043040872 8:75260192-75260214 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1043270794 8:78330277-78330299 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1045472962 8:102528884-102528906 CTGTGACAGACATCCGGTCTGGG - Intronic
1045779914 8:105850338-105850360 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1049898003 9:128806-128828 CTCTGTCAGAGAGAAGGTCTAGG + Intronic
1050987814 9:12104841-12104863 CTATGTCAGAGGAAAGATCTGGG - Intergenic
1051885564 9:21889515-21889537 TTATGTCAGAGGAAAGGTCTGGG + Intronic
1052246967 9:26347578-26347600 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1052731365 9:32290701-32290723 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1053247744 9:36548781-36548803 CTTTGTCAGAGGGAAGGTCTAGG - Intergenic
1053741082 9:41139104-41139126 CTCTGTCAGAGAGAAGGTCTAGG + Intronic
1054346290 9:63968593-63968615 CTCTGTCAGAGAGAAGGTCTAGG + Intergenic
1054444068 9:65295243-65295265 CTCTGTCAGAGAGAAGGTCTAGG + Intergenic
1054486203 9:65726262-65726284 CTCTGTCAGAGAGAAGGTCTAGG - Intronic
1054687267 9:68292193-68292215 CTCTGTCAGAGAGAAGGTCTAGG - Intronic
1055244359 9:74221499-74221521 CTATGTCAGAGGAAAGATCTGGG - Intergenic
1056698950 9:88886551-88886573 CTTTGTCAGAGGGAAGGTCTAGG + Intergenic
1057385573 9:94603322-94603344 CTGTGTGAGACAAAAGGTCCAGG + Exonic
1057453646 9:95188074-95188096 CTGTGTCAGAGAAACAGCCCTGG - Intronic
1058084944 9:100739194-100739216 CTCTGTCAGAGAGAAGGTCTAGG + Intergenic
1058156635 9:101523864-101523886 CTCTGTCAGAGGCAAGGTCTAGG + Intronic
1058410494 9:104725570-104725592 CTCTGTCAGAGAGAAGGTCTCGG - Intergenic
1058770760 9:108228863-108228885 CTCTGTCAGAGGCAAGGTCTAGG - Intergenic
1059609502 9:115877770-115877792 CTCTGTCAGAGGGAAGGTCTTGG + Intergenic
1059827630 9:118049729-118049751 CTGTGTCAGAGGGAAGATCTGGG + Intergenic
1060739103 9:126086272-126086294 CTGTGTCAGGGACCCTGTCTTGG - Intergenic
1062705160 9:137934840-137934862 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1186963161 X:14758737-14758759 CTATGTCAGAGAGAAGATCTGGG - Intergenic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1187681507 X:21771570-21771592 CTCTGTCAGAGGCAAGGTCTAGG - Intergenic
1187748475 X:22434205-22434227 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1187773515 X:22729971-22729993 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1188045800 X:25425488-25425510 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1188389260 X:29600150-29600172 CTGTGTCAGAGGGAAGATCTGGG + Intronic
1189413690 X:40795084-40795106 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1189879094 X:45470848-45470870 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1190342545 X:49308937-49308959 GTGTGTGAAAGAGACGGTCTCGG + Intronic
1190449019 X:50558579-50558601 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1190632106 X:52398338-52398360 CTCTGTCAGAGGGAGGGTCTAGG + Intergenic
1191018794 X:55839246-55839268 CTATGTCAGAGGAAAGATCTGGG + Intergenic
1191151725 X:57227277-57227299 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1191779793 X:64853436-64853458 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1191806962 X:65146589-65146611 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1191903483 X:66063825-66063847 CTTTGTCAGAGGGAAGGTCTAGG + Intergenic
1191965165 X:66750287-66750309 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1192921538 X:75712585-75712607 CTATGTCAGAGAGAAGATCTGGG + Intergenic
1192944931 X:75956588-75956610 CTATGTCAGAGGAAAGGTCTAGG + Intergenic
1192968092 X:76201812-76201834 CTCTGTCAGAGGAGAGGTCTAGG + Intergenic
1193062825 X:77224038-77224060 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1193154680 X:78159420-78159442 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1193253310 X:79318938-79318960 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1193404339 X:81083176-81083198 CTATGTCAGAGGAAAGATCTAGG - Intergenic
1193590833 X:83386786-83386808 CTATGTCAGAGAGAAGATCTGGG - Intergenic
1193680889 X:84518100-84518122 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1193779565 X:85685708-85685730 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1193937716 X:87642404-87642426 CTCTGTCAGAGGGAAGGTCTGGG - Intronic
1194058506 X:89166346-89166368 CTATGTCAGAGGAAAGATCTGGG - Intergenic
1194882484 X:99271479-99271501 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1194967449 X:100304433-100304455 CTGTGTCAGAGAGAAGATCTAGG - Intronic
1195231883 X:102858878-102858900 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1196170982 X:112588122-112588144 CTCTGTCAGAGAAAAGGTCTAGG - Intergenic
1196218990 X:113088908-113088930 CTCTGTCAGAGCGAAGGTCTAGG - Intergenic
1196441185 X:115721478-115721500 ATGAGTAAGAGAAAAGGTCTGGG + Intergenic
1196444713 X:115839466-115839488 ATGAGTAAGAGAAAAGGTCTGGG + Intergenic
1196465694 X:115969520-115969542 ATGAGTAAGAGAAAAGGTCTGGG + Intergenic
1196530727 X:116783084-116783106 CTCTGTCAGAGAGAAGGTCTAGG - Intergenic
1196590405 X:117480972-117480994 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1196737587 X:118993031-118993053 CTCTGTCAGAGGGAAGGTCTAGG - Intronic
1197081655 X:122425878-122425900 CTATGTCAGAGGGAAGGTCTGGG + Intergenic
1197364393 X:125545552-125545574 CTGTGTCAGAGGGAAGTTCTGGG - Intergenic
1197589001 X:128384765-128384787 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1197668989 X:129255356-129255378 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1198020472 X:132652257-132652279 AGGTGTGAGAGAAACTGTCTAGG - Intronic
1198582980 X:138087252-138087274 CTCTGTCAGAGGGAAGGTCTAGG - Intergenic
1199201992 X:145102252-145102274 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic
1199458432 X:148055828-148055850 CTGTCTCAGAGAAATTGTTTAGG + Intergenic
1201377578 Y:13339654-13339676 GTGTGTGAAAGAGACGGTCTCGG + Intronic
1202036322 Y:20640694-20640716 CTCTGTCAGAGGGAAGGTCTAGG + Intergenic