ID: 1156945357

View in Genome Browser
Species Human (GRCh38)
Location 18:42822984-42823006
Sequence TGTGCCCAAGAAAACTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156945354_1156945357 -9 Left 1156945354 18:42822970-42822992 CCCACTGTTGAGACTGTGCCCAA 0: 1
1: 0
2: 1
3: 32
4: 233
Right 1156945357 18:42822984-42823006 TGTGCCCAAGAAAACTATGGTGG 0: 1
1: 0
2: 2
3: 10
4: 146
1156945355_1156945357 -10 Left 1156945355 18:42822971-42822993 CCACTGTTGAGACTGTGCCCAAG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1156945357 18:42822984-42823006 TGTGCCCAAGAAAACTATGGTGG 0: 1
1: 0
2: 2
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156945357 Original CRISPR TGTGCCCAAGAAAACTATGG TGG Intronic
904001452 1:27341286-27341308 TGTGCCCAAGACAACCCAGGAGG + Intergenic
904655222 1:32040529-32040551 TGATCCCAAGAGAGCTATGGAGG + Intronic
905965652 1:42093165-42093187 TGTGCCCAATAAAGTGATGGTGG - Intergenic
909675728 1:78237256-78237278 TGTGAAAAGGAAAACTATGGAGG + Intergenic
912453177 1:109779953-109779975 AGTGCCCAGCAAAGCTATGGGGG - Intergenic
912546685 1:110456375-110456397 TGTGCTCAGGAAAAGGATGGTGG - Exonic
912758466 1:112345037-112345059 TGTGCCACAGAAAACTCTGGAGG - Intergenic
913230673 1:116738306-116738328 TGAGCCCCAGAACACTAAGGAGG - Intergenic
914307527 1:146434755-146434777 TGTGCTCCAAAAAATTATGGAGG - Intergenic
914594581 1:149138383-149138405 TGTGCTCCAAAAAATTATGGAGG + Intergenic
915353526 1:155241368-155241390 TATGCCCTATAAAACTCTGGAGG + Intronic
915645711 1:157270475-157270497 TGTGCCCTAGGAAACTATGGAGG + Intergenic
920369312 1:205467890-205467912 TGTGACCAGGAAAACCCTGGAGG + Intergenic
920671069 1:208003934-208003956 TGTGCCCCATTAAACCATGGGGG - Intergenic
921059128 1:211567717-211567739 TCTGCCCAAGAAAACAGTGCAGG - Intergenic
1066754802 10:38700505-38700527 TATGCCCAACAAAGCAATGGAGG - Intergenic
1067783054 10:49223010-49223032 TGTGCCCAGGGAAGCTATAGGGG - Intergenic
1068809689 10:61241906-61241928 TGAGCACAAGAAAGCTATGTGGG - Intergenic
1074394321 10:113084952-113084974 TTTGCCTCAGAAAACTCTGGTGG - Intronic
1075012394 10:118885904-118885926 TGTGCCCAATTAAAATTTGGAGG + Intergenic
1075318393 10:121470097-121470119 TGTGTCCAGGCAAACTAAGGCGG + Intergenic
1078468790 11:11570472-11570494 TGTGTTCAAGAAACCTAGGGAGG - Intronic
1078901613 11:15647955-15647977 AGTGCCCAATAAAAATATGTGGG + Intergenic
1079071264 11:17349664-17349686 TGTGCCCAGGAAAATATTGGAGG + Intronic
1085364781 11:75929679-75929701 TGTCCCCCACAAATCTATGGAGG - Intronic
1087752791 11:102024091-102024113 TGTGCACAAGAAGTTTATGGAGG + Intergenic
1088765918 11:112977888-112977910 TGTGCCTGAGAAAAAAATGGGGG + Intronic
1088875468 11:113932633-113932655 TGTTTCCAAAACAACTATGGGGG - Intronic
1089441366 11:118520316-118520338 TCTGACCATGACAACTATGGTGG - Intronic
1090467559 11:126948528-126948550 TGAGATCAAGAAAACTATGAGGG + Intronic
1090822195 11:130352962-130352984 TGTATCAAAGAAAACTATGAAGG - Intergenic
1092712115 12:11350337-11350359 TGTGCATAAGAAAAATTTGGAGG + Intergenic
1092831254 12:12446731-12446753 TGTGTAAATGAAAACTATGGAGG - Intronic
1099147328 12:79063400-79063422 TCTGCCCCTGAAAACTATGTAGG + Intronic
1101102312 12:101406887-101406909 TGCTCCCCAGAAAACTGTGGAGG + Intronic
1106375678 13:29184878-29184900 TGTGGCCAAAAAAATCATGGTGG + Intronic
1106585719 13:31054677-31054699 TGTGCACAAGGAAACTGTGTGGG - Intergenic
1109208788 13:59511092-59511114 TGTGTTAAAGACAACTATGGAGG - Intergenic
1109819873 13:67638873-67638895 TGTGCCCAGCAAGACAATGGTGG + Intergenic
1113465166 13:110507591-110507613 TGGCCCCAAGAAAACTCTGATGG - Intronic
1113740107 13:112705688-112705710 TGTGAGCAAGAAAACTAAAGGGG - Intronic
1114246543 14:20919725-20919747 TGAGCCCAGGTAAACTGTGGAGG - Intergenic
1114250495 14:20955856-20955878 TGAGCCCAGGTAAACTGTGGAGG - Exonic
1115354208 14:32430304-32430326 TGAGGCCAAGAAATGTATGGAGG + Intronic
1125628161 15:41126079-41126101 TGTGCCCAAGAGAACCAGGAAGG - Intergenic
1136727886 16:32376333-32376355 TATGCCCAACAAAGCAATGGAGG + Intergenic
1137042795 16:35628794-35628816 TGTGCCTAAAACAACTGTGGGGG + Intergenic
1202998549 16_KI270728v1_random:141421-141443 TATGCCCAACAAAGCAATGGAGG - Intergenic
1203130146 16_KI270728v1_random:1677825-1677847 TATGCCCAACAAAGCAATGGAGG - Intergenic
1143213075 17:5203727-5203749 TGTGCCCAGCAAAGCCATGGGGG + Intergenic
1143417083 17:6758176-6758198 TGTCCCCAAGGAAACCATGGAGG + Exonic
1143819873 17:9551876-9551898 TATGTCCAAAAAAACTAGGGGGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149183115 17:53964125-53964147 TCTGTCTAAGAAAATTATGGGGG - Intergenic
1150693481 17:67384315-67384337 TGTGCGCAAGAAAACTCTCTGGG - Intronic
1156945357 18:42822984-42823006 TGTGCCCAAGAAAACTATGGTGG + Intronic
1157329538 18:46693230-46693252 TGTTCCCAAGAGAACTATGCAGG - Intronic
1157984640 18:52423218-52423240 AATGCCCAAGAAACCTATGCAGG + Intronic
1158330924 18:56361105-56361127 TCTGGACAAGAAAACAATGGAGG + Intergenic
1159547201 18:69854376-69854398 TGTGAGCAAGAAACCCATGGGGG + Exonic
1159922839 18:74241548-74241570 TGTCCCCATAAAAACTATGTTGG + Intergenic
1160212481 18:76893953-76893975 TTTCCCTAAGAAAACTATGTTGG + Intronic
1163747442 19:19056772-19056794 TGTGTCCAAGAATCCTATGCTGG - Intronic
1164444476 19:28305544-28305566 TGTACCCAAGTAAACTGAGGGGG + Intergenic
1164466259 19:28489847-28489869 AGTGCCCAAGTAAACCCTGGCGG - Intergenic
927248644 2:20978698-20978720 TGCTCCCAAGAAGACCATGGTGG + Intergenic
929315117 2:40467722-40467744 TTTCCCAAAGAAAACAATGGTGG + Intronic
930515005 2:52395204-52395226 AGTCTCCAACAAAACTATGGTGG + Intergenic
934164609 2:89282701-89282723 GGTGCCCAAGAAACCAAAGGAGG + Intergenic
934202665 2:89899823-89899845 GGTGCCCAAGAAACCAAAGGAGG - Intergenic
934318089 2:91944740-91944762 TATGCCCAACAAAGCAATGGAGG - Intergenic
934695557 2:96397629-96397651 TGAGCCCAGGAAAGCCATGGAGG - Intergenic
939166955 2:138650479-138650501 TTTGCCTAAGAAAATTAGGGTGG + Intergenic
940372482 2:152918483-152918505 TGTGCCCAGCAAAGCCATGGGGG + Intergenic
941697925 2:168573173-168573195 TGTACCCCAGTAACCTATGGGGG + Intronic
942800548 2:179870313-179870335 TGGGGTCAAGAATACTATGGAGG - Intergenic
943931253 2:193856457-193856479 TGTTCCCCAGTAACCTATGGGGG + Intergenic
948067221 2:235089841-235089863 ATTGCCCAAGAAAACAATGAAGG + Intergenic
1170201057 20:13744609-13744631 TGTGTCCAAGAATAATAAGGAGG - Intronic
1173909863 20:46658971-46658993 TGAGCATAAGAAAACTATTGTGG - Intronic
1175656715 20:60777083-60777105 TGGGCCCAAGATGACTCTGGAGG + Intergenic
1178006685 21:28228401-28228423 TGTGTCCAAGAGAACTATAGAGG + Intergenic
1179457492 21:41508926-41508948 TGTGCCAAAGAGGACTATGTTGG - Intronic
1180306260 22:11128425-11128447 TATGCCCAACAAAGCAATGGAGG - Intergenic
1180544779 22:16490608-16490630 TATGCCCAACAAAGCAATGGAGG - Intergenic
949718213 3:6958148-6958170 GGGGCACAAGAAAACTTTGGGGG - Intronic
950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG + Intergenic
951301154 3:20998669-20998691 TGTGCCGAAGAATAGCATGGTGG - Intergenic
952573159 3:34742287-34742309 TGAGCACAAGGATACTATGGTGG - Intergenic
952641446 3:35601561-35601583 TGTTCCCATGAAAATAATGGAGG + Intergenic
952839978 3:37638060-37638082 TTTGCCCATCAAAATTATGGAGG + Intronic
954783644 3:53077808-53077830 AGAGGCCAAGAAAACCATGGAGG - Exonic
956177712 3:66489035-66489057 TGGCCCAAAGAAAACTGTGGAGG - Intronic
956916355 3:73875964-73875986 TGGGCCCAGGAAGACCATGGTGG - Intergenic
959754567 3:109882622-109882644 TGTACACATGAAAACGATGGAGG + Intergenic
960121343 3:113951050-113951072 TGTGCGCAACAAAGCTGTGGTGG - Intronic
962188201 3:133282227-133282249 TGTGGCCAAGAAAACTCAGCTGG - Intronic
962878767 3:139556343-139556365 TGGGCACAAGAAAATTTTGGGGG - Intergenic
963118296 3:141752870-141752892 TGTACCCAAGAAAACTATGTAGG + Intergenic
963681852 3:148388220-148388242 TGTGCCCAGCAAAGCTATGGTGG - Intergenic
964384091 3:156128733-156128755 TGTGCCAAAGATAATTTTGGGGG + Intronic
969157407 4:5223448-5223470 TGTGCCCAGCAAAGCTATGGGGG + Intronic
976857410 4:89621382-89621404 TGTGCCATAGTAAACTATGTGGG + Intergenic
977950574 4:102966027-102966049 TATGCCCAACAAAGCAATGGAGG - Intronic
978263244 4:106789179-106789201 TGTGCCCCAAAAGACTAGGGAGG + Intergenic
980469373 4:133231669-133231691 AGTACCCAAGAAATATATGGAGG + Intergenic
981500860 4:145449948-145449970 TGTGCCCAGGAAAACTAGATTGG + Intergenic
984222227 4:176992597-176992619 TGTGCCCAGGAAAGCTATGAGGG + Intergenic
984348061 4:178557190-178557212 TGTGCCCCAGAAAATTATCCAGG + Intergenic
986609598 5:9553228-9553250 TGTGCCCAGCAAAGCCATGGGGG - Intergenic
986674927 5:10175708-10175730 TTTTCCTAAGAAAACTAAGGAGG + Intergenic
988575859 5:32423915-32423937 TGTACCCAGCCAAACTATGGAGG + Intronic
988783798 5:34547474-34547496 CATGACCAAGAAAACTAAGGAGG + Intergenic
990846639 5:60147957-60147979 TGTGGCCAAGAAAATTCAGGAGG - Intronic
992040933 5:72831028-72831050 TCTGCCGAAGAAAACTAATGTGG - Intronic
993810920 5:92474589-92474611 TATGCCCAGCAAAGCTATGGGGG + Intergenic
994024984 5:95071609-95071631 TGTGCCCCCAGAAACTATGGAGG - Intronic
999827241 5:155285536-155285558 TGTGCCCAAAATTTCTATGGAGG + Intergenic
1000061594 5:157661950-157661972 AGTTCCCAATAAAACCATGGAGG + Intronic
1001780746 5:174367026-174367048 TCTGCCTTAGAAAACCATGGGGG - Intergenic
1002806240 6:577279-577301 TGTGTCCAAGAAACAAATGGTGG - Intronic
1004783887 6:18944119-18944141 TTTGCCCAAGAAAAGTAAGTAGG - Intergenic
1006938886 6:37738254-37738276 TGTCCCCACCAAAACCATGGGGG - Intergenic
1007308863 6:40929102-40929124 TGTGCACTAGAAAAATCTGGTGG - Intergenic
1012102317 6:95105303-95105325 TGTGCCCAGCAAAAACATGGAGG + Intergenic
1012462488 6:99479090-99479112 GGGGCCCAACAAAACTTTGGGGG + Intronic
1015670920 6:135688697-135688719 TGACCACAAGAACACTATGGGGG + Intergenic
1018523740 6:164683811-164683833 GGTGCCAAAGAACTCTATGGTGG + Intergenic
1018906817 6:168080332-168080354 TGTGCCCAAGACAGCAGTGGCGG + Intronic
1018965024 6:168478290-168478312 TGTAGCCAAGAAAATGATGGTGG + Intronic
1019100155 6:169623609-169623631 GGTGCCCAAGAGAGCCATGGTGG + Intronic
1021093723 7:16511680-16511702 TGAGCCCAAGAAAGGTAAGGAGG + Intronic
1022422707 7:30238988-30239010 TTTGCCCAAGAAATGTAGGGTGG + Intergenic
1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG + Intronic
1028178478 7:87685998-87686020 CTTGGCCAAGAAAAATATGGAGG - Intronic
1028674334 7:93441859-93441881 TGTGGCCAAGAAAATTGAGGGGG - Intronic
1028969015 7:96836110-96836132 TGTTCCCAAGAAACTTAAGGAGG - Intergenic
1034326431 7:150237994-150238016 TGAGGCCAAGAACACTATGCGGG - Intergenic
1034766782 7:153731263-153731285 TGAGGCCAAGAACACTATGCGGG + Intergenic
1035176874 7:157057657-157057679 TGGGTCCAAGATAACTCTGGAGG - Intergenic
1037145514 8:15567090-15567112 TGTGACCCAGAAAGATATGGTGG - Intronic
1037835356 8:22212160-22212182 TGTGCCCCAGGAAACTGGGGTGG - Exonic
1037964538 8:23123866-23123888 AGTGCCCAAGAAATCAATGGTGG - Intergenic
1038061588 8:23919995-23920017 TGTGTCAAAGAAAACTGTGAAGG - Intergenic
1039636676 8:39174846-39174868 AGTGCTCAAGAAAATTAGGGAGG - Intronic
1040011644 8:42666101-42666123 TCTGGCCAATGAAACTATGGGGG - Intergenic
1040325696 8:46340416-46340438 TCTGCCCAAGACAATTCTGGAGG - Intergenic
1041425953 8:57720853-57720875 TGTGGCTAATGAAACTATGGTGG + Intergenic
1043334074 8:79151422-79151444 TGTGCCCAGCAAAGCCATGGGGG + Intergenic
1044082595 8:87903939-87903961 TGTGCCCAACAAAGCTGTAGAGG - Intergenic
1046951613 8:120024866-120024888 TGTGCCCAGAAAAATAATGGGGG + Intronic
1056904271 9:90631872-90631894 TGAGGCAAAGAAAACTATAGGGG - Intronic
1059231558 9:112725794-112725816 TGTGCCCAGGAAAGCCATGGGGG - Intergenic
1187104159 X:16223063-16223085 TGTGCCCAGGAAAGCCATGGGGG - Intergenic
1193511764 X:82410930-82410952 TGTGCCCAGTAAAGCCATGGAGG - Intergenic
1195532231 X:105969968-105969990 TGCACCCAAGAAAGCCATGGAGG - Intergenic
1195726396 X:107921817-107921839 AGTGCTCAAGAAAATGATGGGGG - Intronic
1199152372 X:144502723-144502745 TGTGTCCAAGAAATATATGTAGG - Intergenic
1202114536 Y:21458095-21458117 GGTGGCCAAGAAAGCTATGTGGG + Intergenic