ID: 1156946976

View in Genome Browser
Species Human (GRCh38)
Location 18:42844864-42844886
Sequence TCACTACTTTTGATAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156946976_1156946979 -8 Left 1156946976 18:42844864-42844886 CCACCCTCTATCAAAAGTAGTGA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1156946979 18:42844879-42844901 AGTAGTGACAGATACATAACAGG 0: 1
1: 0
2: 2
3: 14
4: 169
1156946976_1156946980 29 Left 1156946976 18:42844864-42844886 CCACCCTCTATCAAAAGTAGTGA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1156946980 18:42844916-42844938 GTGATTATTAATTGTACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156946976 Original CRISPR TCACTACTTTTGATAGAGGG TGG (reversed) Intronic
901011054 1:6202339-6202361 TTAGTATTTTTTATAGAGGGGGG + Intronic
901166274 1:7223947-7223969 TCACTGCAGTTGTTAGAGGGCGG + Intronic
903567210 1:24277011-24277033 ACCCTAGTTTTTATAGAGGGTGG - Intergenic
911332664 1:96542992-96543014 TTCCTACTTTTGATAGAGACAGG - Intergenic
915691329 1:157694174-157694196 TAAATACTTTTGATGGAGAGTGG + Intronic
916996851 1:170310305-170310327 TCACTACTTTTGAAACACTGGGG + Intergenic
918841227 1:189542272-189542294 TCACTAGATTTGATAGATGAGGG - Intergenic
920918598 1:210279072-210279094 TGAGTACTTTTCCTAGAGGGAGG + Intergenic
921201160 1:212807822-212807844 CCACTTCTTATGATAGAAGGGGG - Exonic
921490448 1:215769573-215769595 TAAGGATTTTTGATAGAGGGAGG + Intronic
1062785102 10:258070-258092 TTAATACTTTTGAAAGTGGGGGG + Intergenic
1063603556 10:7503664-7503686 TTACTACTATTAATAAAGGGAGG + Intergenic
1064160655 10:12942806-12942828 TCTCTCCTTTGGAGAGAGGGGGG - Intronic
1064413658 10:15130091-15130113 TCAACATTTTTGATAAAGGGAGG + Intronic
1064943905 10:20767216-20767238 TCACAAGTTTTGAAAAAGGGTGG - Intergenic
1065385730 10:25131397-25131419 TCCCCACTTTTGGCAGAGGGTGG - Intergenic
1068694570 10:59952127-59952149 ACAATAATTTTTATAGAGGGGGG - Intergenic
1068914473 10:62413833-62413855 TCAGAAGTTTTGATAGAGGATGG - Intronic
1072173895 10:92896725-92896747 TCAGTATTTTTGGTAGAGGTGGG + Intronic
1078977502 11:16495346-16495368 GCACTAGTTTTGATAGGTGGGGG - Intronic
1080007671 11:27426972-27426994 TCATTACTTTAGCTACAGGGAGG - Intronic
1081463000 11:43289066-43289088 TCACCACTACTGAGAGAGGGAGG + Intergenic
1083036628 11:59643684-59643706 ACACTTCTTTTGAGACAGGGTGG - Intronic
1084440320 11:69169018-69169040 TCACTACTTTTTTTGGGGGGGGG - Intergenic
1086230463 11:84563402-84563424 TCACTAATTATGTTAGAAGGAGG - Intronic
1087603024 11:100339682-100339704 TCCTTACTGTTGATAGAGGAAGG - Intronic
1087901387 11:103645657-103645679 TCATTATTTTTGGTAGAGGCAGG - Intergenic
1094408139 12:30140723-30140745 ACACTACTGTTGATAAAGAGAGG + Intergenic
1096147523 12:49289467-49289489 TTTCTACTTTTGGTAGAGAGGGG - Intergenic
1099009741 12:77277594-77277616 TCTGTACATTTGATACAGGGAGG + Intergenic
1103221387 12:119248926-119248948 TCACTCCTTGAGATAGAAGGAGG - Intergenic
1109405838 13:61898859-61898881 CCACTTCTTTTGAGGGAGGGAGG - Intergenic
1110497112 13:76180969-76180991 TCATTACTCTTGAGAGAGAGGGG - Intergenic
1125013557 15:34907360-34907382 TCTCTACTTTTAATAGAGCTGGG - Intronic
1126621031 15:50640267-50640289 TCACTTCTTTTTTTTGAGGGAGG + Intronic
1133199564 16:4194866-4194888 AAACTACTTTTGACAGTGGGTGG - Intronic
1135189510 16:20343511-20343533 TCTCTACTTTTCAAAGAGGCAGG - Intronic
1137478505 16:48831333-48831355 CCACTTCTTTGGATGGAGGGAGG - Intergenic
1137853700 16:51772237-51772259 TCACTACTTTTGATAGTTTGTGG + Intergenic
1146780066 17:35662043-35662065 TCACTACTATTGATGGAGGAAGG - Intronic
1147551231 17:41443443-41443465 TCACTAATTTTGATACATAGGGG + Intergenic
1153067613 18:1063792-1063814 TCACTTCTCTGTATAGAGGGAGG + Intergenic
1153204915 18:2688779-2688801 TTACTCCTTTGGATAGACGGTGG + Intronic
1153545254 18:6198230-6198252 TCACTACTGTTGAGAGTGAGTGG - Intronic
1153572421 18:6486543-6486565 TCACGAGTTTTGAAGGAGGGAGG + Intergenic
1156946976 18:42844864-42844886 TCACTACTTTTGATAGAGGGTGG - Intronic
1156967370 18:43110955-43110977 TAGCTACTTTTTATAGGGGGTGG + Intronic
1157249636 18:46083266-46083288 TTTCTACTTTTTGTAGAGGGAGG - Exonic
1161867679 19:6846413-6846435 TCTGTACTTTTAATAGAGGCGGG - Intronic
1167872295 19:52381119-52381141 TTACTACTTTTAATAGAGATGGG + Intronic
928289956 2:30028413-30028435 TCACTACCTTGGATAGAGACTGG + Intergenic
928501617 2:31902243-31902265 TCACTATTTTTAGTAGAGGTGGG - Intronic
929315323 2:40471177-40471199 TCAATACTTATGTCAGAGGGTGG - Intronic
937455124 2:122034658-122034680 TCACTATTTTTGATAGACAAAGG - Intergenic
939393879 2:141604395-141604417 ATACTACTATTGATAGAGGCAGG + Intronic
939864879 2:147461434-147461456 TCACTACTTTTCATGGAACGTGG + Intergenic
941183536 2:162291112-162291134 TCAATACTTGTTGTAGAGGGAGG - Intronic
941582212 2:167313257-167313279 TCCCTACTTTTTATAGAAGAAGG + Intergenic
945254764 2:207794342-207794364 TAACTACATTTGAAAGATGGGGG + Intergenic
1173380012 20:42531741-42531763 TCACTACTTTGGATAGATGTTGG + Intronic
1173741220 20:45403793-45403815 TTTCTATTTTTGGTAGAGGGGGG - Intronic
1173940546 20:46907478-46907500 TCACTCGTCTTGAAAGAGGGTGG - Intronic
1174356501 20:50001748-50001770 TTACTACTTTTTGTAGAGGTGGG - Intergenic
1174500848 20:50982893-50982915 TGTCTACTTTTGATGGATGGGGG - Intergenic
1176856898 21:13981118-13981140 AGACTACTCATGATAGAGGGGGG - Intergenic
1178995976 21:37400218-37400240 TCACAAATGTTGAGAGAGGGAGG - Intronic
1180854713 22:19038688-19038710 TCACTTCTTTTGGCAGAAGGCGG + Exonic
949731630 3:7120384-7120406 GCAGTACTTATGATAGAGAGTGG - Intronic
960435330 3:117619591-117619613 TCTCTGCTTTTGTTAGAGAGAGG - Intergenic
964466759 3:157001329-157001351 TCACTTCTTTTAACAGAGGCAGG + Intronic
966581944 3:181576985-181577007 TCTCTACTTTTGGTAGAGATAGG - Intergenic
967353903 3:188546427-188546449 TCATTACCTTTGAGAGAGGTGGG + Intronic
969933500 4:10657854-10657876 TGACTACTTAGGATAGATGGTGG - Intronic
973341989 4:49014811-49014833 TGAGTAATTTTGATAGTGGGGGG - Intronic
973792866 4:54394637-54394659 TCACCACTGTTCAGAGAGGGAGG - Intergenic
973872494 4:55180294-55180316 TCAACACTTTTGAGAGTGGGAGG + Intergenic
974672585 4:65052029-65052051 TGAATACTATTGATAGAGGCAGG + Intergenic
975927367 4:79474188-79474210 TCACTACTTTTGATATAAAAAGG - Intergenic
979862387 4:125709588-125709610 TCTCTACTATTTATAGGGGGAGG - Intergenic
983621617 4:169767378-169767400 TTACTACTTTTTATAGAGACAGG - Intergenic
987624025 5:20374405-20374427 TAACTACCTTTGATAGTGAGAGG - Intronic
987812153 5:22851556-22851578 TCAGTAGTTTTCATAGAAGGTGG + Intronic
987934987 5:24451858-24451880 TCAAAACTTTTGCCAGAGGGAGG + Intergenic
992690794 5:79237895-79237917 TTACTACTTTTGATAAATGGGGG - Intronic
997396217 5:133562046-133562068 TCACTGCATGTGAGAGAGGGTGG + Intronic
997407270 5:133660770-133660792 TCACTAATTTTGATAGATTGAGG + Intergenic
997988863 5:138527181-138527203 TAGCTATTTTTGATAGTGGGAGG - Intronic
999978494 5:156936259-156936281 TAACTAATCTTGATTGAGGGAGG + Intronic
1000506166 5:162121092-162121114 TCCATACTTTTGACAGAGGGAGG - Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1004727137 6:18322005-18322027 TCAGTACTTTTAATAGAGACGGG + Intergenic
1010294657 6:74182341-74182363 GAACTCCTTTTGATAGAGGCAGG + Intergenic
1011573685 6:88769330-88769352 TTTCTATTTTTGGTAGAGGGGGG + Intronic
1016840818 6:148523294-148523316 TCACTGCTTTTGCAAGAAGGAGG + Intronic
1020596187 7:10211000-10211022 TCAATACTTCTGAAAGAAGGGGG - Intergenic
1020748838 7:12112878-12112900 TCAATAGTTTTGAAAGAGGGAGG - Intergenic
1028378196 7:90169820-90169842 TCAGTACTTTTGCTATAGTGAGG + Intronic
1033143097 7:138845243-138845265 TCACTACTTTTTTTTGAGGGAGG - Intronic
1033790544 7:144788243-144788265 GTACAACTTTTGACAGAGGGAGG + Intronic
1038676536 8:29627934-29627956 TCACTACTTTTTTTGGAGGGGGG - Intergenic
1041121437 8:54590412-54590434 TCACTGCTTGTGCAAGAGGGAGG - Intergenic
1041721180 8:60976885-60976907 TCACTGCTTTTGATTGTGGAGGG + Intergenic
1044618974 8:94170587-94170609 TCTCTGCTTTTGACAGAGGGTGG - Intronic
1044622657 8:94205242-94205264 TCACTATTTCTCATAAAGGGTGG + Intronic
1046424439 8:114028207-114028229 TCAATACTTGTGAAAGAAGGAGG + Intergenic
1047027464 8:120839596-120839618 TCCCGATGTTTGATAGAGGGGGG + Intergenic
1052984775 9:34478916-34478938 TCAGTACTTGTGATGGAAGGTGG + Intronic
1056196596 9:84235129-84235151 TCATTACATTTCATCGAGGGTGG - Intergenic
1060571599 9:124645683-124645705 TGTCCATTTTTGATAGAGGGTGG - Intronic
1186329307 X:8515201-8515223 TCAATACTTTTAATAAATGGTGG - Intergenic
1189319989 X:40082166-40082188 TCACATCTTTTCACAGAGGGTGG - Intronic
1192304509 X:69944626-69944648 GCACTGCTTTTGGTTGAGGGAGG + Intronic
1198082357 X:133251842-133251864 TTTCTACTTTTTATAGAGGTGGG - Intergenic