ID: 1156951242

View in Genome Browser
Species Human (GRCh38)
Location 18:42900995-42901017
Sequence GCATTTTTACTGATGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156951242 Original CRISPR GCATTTTTACTGATGGTGCA AGG Intronic
905330327 1:37190664-37190686 ACAATATTACTGAAGGTGCATGG + Intergenic
906874100 1:49517020-49517042 GTATTATTTATGATGGTGCATGG + Intronic
909890336 1:80997332-80997354 GGATTGTGACTGATGCTGCAAGG + Intergenic
910448545 1:87324300-87324322 GCATTTTGCCTGATGTAGCAAGG - Intergenic
911126724 1:94347349-94347371 GCATTGTTACTGAGCGTTCATGG - Intergenic
912784602 1:112588358-112588380 GCCTTTTTTCTGATGGTGGAGGG + Intronic
913089471 1:115466649-115466671 GCATTGGGACTGAAGGTGCAGGG - Intergenic
919199479 1:194336410-194336432 AAGCTTTTACTGATGGTGCAAGG + Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921413688 1:214866225-214866247 GCATTTTCAATCATGGTGGAAGG + Intergenic
921730891 1:218576772-218576794 CTATTTTTTCTGATGCTGCAGGG - Intergenic
921897399 1:220414677-220414699 GAACTTTTACTCATGGTGGAAGG - Intergenic
922350326 1:224729922-224729944 GCATTTTGCCTGATGGTGGATGG - Intronic
923270434 1:232350532-232350554 ACATTTTTACATATGGTGTATGG - Intergenic
924275558 1:242382617-242382639 GCATTTTTACTGGTGTGGTAAGG + Intronic
1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG + Intergenic
1064871169 10:19938436-19938458 GGAGGTTTACTGATGGTGGAAGG + Intronic
1070039716 10:72764010-72764032 GCTTATTTACTGATGGTAAATGG - Intronic
1070581490 10:77723692-77723714 GAGCTTTTACTGATGGTGGAAGG - Intergenic
1079008391 11:16809108-16809130 GCATTTTACTTGATGGTGCCAGG - Intronic
1079389326 11:20007398-20007420 GAATTTTTCCTGGAGGTGCAGGG + Intronic
1079898015 11:26147437-26147459 GCATTATAACTCATGGTGAAAGG - Intergenic
1080282697 11:30576648-30576670 GTATTTTTAATGATGGTGGGAGG - Intronic
1080840522 11:35979434-35979456 GGATATTTATTGATGGTGGAAGG + Intronic
1081199956 11:40203754-40203776 GCATTTTTAGTGAGGGAGCTTGG - Intronic
1082219270 11:49613837-49613859 GCTTTATAACTTATGGTGCAAGG - Intergenic
1087621419 11:100547215-100547237 GGAGTTTTACTCATGGTGGAAGG - Intergenic
1088102576 11:106171477-106171499 GCAGCTTTACTGATAGTGAACGG + Intergenic
1088872599 11:113903850-113903872 GCTTTCTTACTGTTGGTGAAGGG - Intergenic
1089281615 11:117378874-117378896 GCCTTTTTTCTTATGGTGTATGG + Intronic
1093395505 12:18676432-18676454 GCATTTTCACTGAAGAAGCAAGG - Intergenic
1093892142 12:24534907-24534929 GCATGTTTTCTGAGAGTGCAGGG - Intergenic
1095407750 12:41886631-41886653 AAATTTCTACTGATGATGCATGG + Intergenic
1095782834 12:46079082-46079104 GAAATTTTACTCATGGTGGAAGG + Intergenic
1096844728 12:54399909-54399931 CCGTTTTTGCTGGTGGTGCAGGG + Exonic
1098593759 12:72246224-72246246 GCATTTTTGCTGAAGGTGTAGGG - Intronic
1099591551 12:84597796-84597818 GCATTTTTCCTGATAGAGAAGGG + Intergenic
1104148391 12:126057181-126057203 GCATTTTTCCTGATCGAGTAAGG - Intergenic
1106518236 13:30473531-30473553 GCATTTATTCTGAAGGTGTAAGG - Intronic
1107293290 13:38881708-38881730 ACATTGTTACAGATGGTGAAGGG + Exonic
1107294064 13:38891098-38891120 ACATGTTTAATGATGGTGGATGG - Intergenic
1108064871 13:46566742-46566764 GCATTTCTACAGATGGTCCTCGG + Intronic
1110313480 13:74077827-74077849 GCAGTTTAACTGATGCTACAAGG - Intronic
1113285626 13:108845414-108845436 GCAGGTTGACTGAAGGTGCAGGG + Intronic
1114309625 14:21455288-21455310 GCATTTATACAGCTGCTGCAGGG + Intronic
1115789806 14:36866084-36866106 GCATGTTTTCTGGTGGTGCTGGG - Intronic
1116017750 14:39427648-39427670 GCATTTTTAGGCAGGGTGCAGGG + Intronic
1116408425 14:44594463-44594485 GCATTCTCACTGGGGGTGCAAGG + Intergenic
1117206105 14:53445380-53445402 GGATTTTAATTGATGGTACATGG - Intergenic
1117573022 14:57068098-57068120 GCATTTTTCCTGAAGGTAAAAGG + Intergenic
1120219998 14:81721136-81721158 GTACATTTATTGATGGTGCAAGG + Intergenic
1124106720 15:26745000-26745022 GAACTTTTACTCATGGTGGATGG + Intronic
1125174246 15:36802577-36802599 GCATCTTTACTTATGGAGAATGG - Intronic
1125573616 15:40739891-40739913 GCTTTTTTTCTGATGGGGCTTGG - Intronic
1126203707 15:46018876-46018898 GAAATTTTACTTATGGTGGAAGG - Intergenic
1126999145 15:54481784-54481806 TCATGTCTCCTGATGGTGCATGG + Intronic
1129018299 15:72489374-72489396 GCATTTGTGCTGATGTTGCAGGG + Intronic
1134883994 16:17773767-17773789 GCATATTTTCTGACTGTGCAGGG + Intergenic
1136364124 16:29800961-29800983 GCATTTTTGCTTCTGGTTCAAGG + Intronic
1138862082 16:60770963-60770985 TCATATTTACTGATTGTGCAAGG - Intergenic
1138902079 16:61285024-61285046 ATATTTGTACTGATGGTTCAAGG - Intergenic
1141816797 16:86416080-86416102 GCTGTTTTACTCAGGGTGCAGGG + Intergenic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1149457857 17:56802912-56802934 GCATTTTCACTGATGTGCCAAGG + Intronic
1151382734 17:73736764-73736786 GGAGTTTTACTCATGGTGGAAGG - Intergenic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1153189962 18:2527123-2527145 GCTATTTTACAGATGGTGAAAGG - Intergenic
1155790581 18:29964211-29964233 ACATTTTTATTGAGGGTGAATGG + Intergenic
1156439511 18:37169897-37169919 GAATTTTAACAGATGGTCCAGGG - Intronic
1156696469 18:39773823-39773845 GGGTTTTTACTCATGGTGGAAGG - Intergenic
1156951242 18:42900995-42901017 GCATTTTTACTGATGGTGCAAGG + Intronic
1157156283 18:45269537-45269559 GCAGTTTGACTGATGATGGAGGG - Intronic
1157543833 18:48533797-48533819 GAAGTTTTACTCATGGTGCAAGG + Intergenic
1158257508 18:55569846-55569868 GCATTTTTATTGAAGTTGCATGG - Intronic
1158569764 18:58588194-58588216 CCATTTTTACTGATGCATCAAGG + Intronic
1161494492 19:4580108-4580130 GCAATTTTACAAATGGGGCAGGG + Intergenic
1162456811 19:10790069-10790091 GCATTTTATCTGAGGGTCCAAGG + Intronic
1164928810 19:32155736-32155758 GCAGCCTTACTGATGGTGAAAGG - Intergenic
925454643 2:4005070-4005092 GCATCATTTCTGATAGTGCAGGG - Intergenic
925632248 2:5906581-5906603 GCATTTTTACTCTTGTTGCTTGG + Intergenic
925731534 2:6922501-6922523 GCATGTTTATTGTTGATGCATGG + Intronic
926334810 2:11855151-11855173 GCATTTGCACAGATGATGCAGGG + Intergenic
929023092 2:37573669-37573691 GTATTTTTACTGATACTACAAGG + Intergenic
929038735 2:37722554-37722576 GCATCTCTACTGGTGGAGCAAGG + Intronic
929152979 2:38764447-38764469 GCATTTTTACTCAGAGTGAATGG + Intronic
929505680 2:42526107-42526129 GCATTGTTACTGTTGGTTCTGGG - Intronic
929836253 2:45402986-45403008 GCAATTTTACTTATGGTTTATGG + Intronic
930219605 2:48733118-48733140 TCAGTTTTATTGATGCTGCAAGG - Intronic
931410592 2:62026307-62026329 GAGTTTTTACTCATGGTGGAAGG + Intronic
931747335 2:65301583-65301605 CCATAGTTACTGATGGAGCATGG + Intergenic
932472261 2:71967701-71967723 GGAGTTTTACTCATGGTGGAAGG - Intergenic
932899157 2:75678101-75678123 GCATTTTTACAGATGAAGCTGGG - Intronic
933645414 2:84809151-84809173 GCATTTGTAATGATGGTCAAAGG + Intronic
934059004 2:88276692-88276714 GCACTTTTCCTGGTGGGGCATGG - Intergenic
934894964 2:98109322-98109344 GCTTTTTTAGTGATTGTGCTAGG + Intronic
935130718 2:100258985-100259007 CAATTTTTACTGGTGGTGTAAGG - Intergenic
938687935 2:133759227-133759249 TCATTTTTACTAATTGTGGAAGG + Intergenic
939259123 2:139784122-139784144 GAAGTTTTACTCATGGTGGAAGG + Intergenic
944331278 2:198469319-198469341 GAACTTTTACTCATGGTGGAAGG + Intronic
944819649 2:203417200-203417222 GCATTTTTACTGAGTTTACAAGG + Intronic
946752144 2:222903073-222903095 CCATTTTTACTGATGCTACTAGG - Intronic
948952522 2:241263423-241263445 GCATTCTGCTTGATGGTGCAGGG + Intronic
1174252680 20:49231205-49231227 GCATTGTCACTGAGGGTTCATGG + Intronic
1177883075 21:26717268-26717290 GCATTTTTACTGTTTGGGGAAGG - Intergenic
1178310252 21:31524247-31524269 GAGCTTTTACTCATGGTGCAAGG + Intronic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
951226198 3:20124362-20124384 GAACTTATACTCATGGTGCAGGG + Intronic
952800007 3:37281562-37281584 GCACTGTTACAGATGGTGTATGG + Intronic
953706634 3:45236108-45236130 GAGTTTTTACTCATGGTGGAAGG - Intergenic
955054726 3:55445110-55445132 CCATTTTTATTCATGGAGCAGGG - Intergenic
957768689 3:84659345-84659367 GAACTTTTACTGATTGTGGAAGG - Intergenic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
963352595 3:144170255-144170277 AAACTTTTACTGATGGTGGAAGG - Intergenic
967131522 3:186475518-186475540 ATATTTGTGCTGATGGTGCAGGG + Intergenic
975244182 4:72099509-72099531 GAGTTTTTACTCATGGTGGAAGG + Intronic
976015415 4:80546751-80546773 GAACTTTTACTCATGGTGTAAGG - Intronic
979712679 4:123798661-123798683 GAATTTTTACATATGGTGTAAGG + Intergenic
980251997 4:130328892-130328914 GCATGTTTTCTGATAGTGCAAGG + Intergenic
980328955 4:131386452-131386474 TAATTTTTACTTATGGTGTAAGG + Intergenic
983733917 4:171033752-171033774 GTACTTTTACTCATGGTGGAAGG - Intergenic
984788643 4:183592939-183592961 GCATTTGTGCGGATGCTGCAGGG - Intergenic
985173914 4:187180716-187180738 GCATTTTTACAGATATTGAAAGG + Intergenic
986934534 5:12866755-12866777 GAGTTTTTACTCATGGTGGAAGG - Intergenic
987264913 5:16243261-16243283 GAGCTTTTACTGATGGTGGAAGG - Intergenic
987693309 5:21296602-21296624 ACATTTTTACTGATGGCGAAAGG - Intergenic
988876829 5:35456314-35456336 GAACTTTTACTCATGGTGGAAGG - Intergenic
990434511 5:55774684-55774706 TCATTTTTATAGATGGTGTAGGG + Intronic
991746968 5:69752954-69752976 ACATTTTTACTGATGGCGAAAGG + Intergenic
991750737 5:69802288-69802310 ACATTTTTACTGATGGCGAAAGG - Intergenic
991798570 5:70332896-70332918 ACATTTTTACTGATGGCGAAAGG + Intergenic
991826345 5:70628266-70628288 ACATTTTTACTGATGGCGAAAGG + Intergenic
991830026 5:70677185-70677207 ACATTTTTACTGATGGCGAAAGG - Intergenic
991890901 5:71332219-71332241 ACATTTTTACTGATGGCGAAAGG + Intergenic
992290513 5:75274822-75274844 GGATTTTAACTGATGGTGAGGGG - Intergenic
992471215 5:77056617-77056639 TCATTTTTATAGATGGTTCAAGG - Intronic
994221539 5:97201378-97201400 GGAGTTTTACTCATGGTGGAAGG + Intergenic
994500063 5:100564097-100564119 GAGCTTTTACTCATGGTGCAAGG - Intronic
994681871 5:102898133-102898155 GCCTTTTTACTGATGCTACTGGG - Intronic
995460769 5:112400477-112400499 GAGCTTTTACTGATGGTGGAAGG + Intronic
995671918 5:114614606-114614628 GGATTTTGACTGAGAGTGCATGG - Intergenic
997926784 5:138037641-138037663 GTTTCCTTACTGATGGTGCAAGG - Intronic
998018294 5:138750484-138750506 GAACTTTTACTCATGGTGGAAGG + Intronic
1000830068 5:166092190-166092212 GAATATTTACTTATGGTGGAAGG + Intergenic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1003934159 6:10958308-10958330 GGAGTTTTACTCATGGTGGAAGG + Intronic
1004320602 6:14628750-14628772 GGCTTGTTAATGATGGTGCAGGG - Intergenic
1004322357 6:14641961-14641983 GGATTGTTACTGTTGGTGAATGG + Intergenic
1008653070 6:53583313-53583335 GAACTTTTACTCATGGTGGAAGG - Intronic
1008898288 6:56582462-56582484 GAACTTTTACTCATGGTGCAAGG - Intronic
1009248353 6:61268597-61268619 GCACTTTTACTCAAGGTGGAAGG + Intergenic
1010882345 6:81193518-81193540 GCCTTCTTACTGATGTTGGAAGG - Intergenic
1011724621 6:90197652-90197674 GCCTCTTTACTGAGGCTGCATGG + Intronic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1012924855 6:105257033-105257055 GCATTTTTATTGATGATCTATGG + Intergenic
1014625824 6:123723201-123723223 GCATATTTATTGAAGATGCATGG - Intergenic
1015218984 6:130782490-130782512 GAGTTTTTACTCATGGTGGAGGG - Intergenic
1016441826 6:144092328-144092350 TTGTTTTTACTGAGGGTGCATGG - Intergenic
1016468727 6:144352549-144352571 GCATTTCTCCTGCTGTTGCAAGG + Intronic
1020991535 7:15202803-15202825 GCACTTCTTCTGATGGTGCCAGG + Intronic
1021352042 7:19605804-19605826 GCACTTTCACTGCTGGTGGATGG - Intergenic
1021626953 7:22602978-22603000 GCATTGGTACTGAAGGTGAATGG - Intronic
1022060421 7:26787632-26787654 GCTTTTTTACTCATGGTGAAAGG + Intronic
1022302621 7:29115362-29115384 GCTTTTTTTCTGATGGAGGAGGG - Intronic
1027701318 7:81473179-81473201 CCATTTTTACTGCTGGTGCAGGG - Intergenic
1028051672 7:86195506-86195528 GCATTTCTACTGATGAAGTAAGG - Intergenic
1032423981 7:131805721-131805743 GCATTTTTATGCATGGTGCAAGG + Intergenic
1036172207 8:6498626-6498648 GCATTTTTAAGGCTGGTTCATGG + Intronic
1036448317 8:8842775-8842797 GGATTTCTCATGATGGTGCATGG - Intronic
1037005397 8:13773012-13773034 GGGTTTTTACTGATAATGCATGG - Intergenic
1039722436 8:40179095-40179117 CCATTTTAACTGTTAGTGCAAGG - Intergenic
1043553437 8:81401677-81401699 GCATCTTTGGTGATGCTGCATGG + Intergenic
1043721867 8:83554740-83554762 GAGTTTTTACTCATGGTGGAAGG - Intergenic
1045355887 8:101388756-101388778 ACATTTTTATTTGTGGTGCAGGG + Intergenic
1046671571 8:117062380-117062402 GAACTTTTACTTATGGTGGAAGG + Intronic
1047783968 8:128135682-128135704 GCATTTTCACTGCTGCTCCAAGG + Intergenic
1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG + Intergenic
1048904272 8:139072630-139072652 GCATTTTTAACTATGGTACATGG - Intergenic
1051608344 9:18938379-18938401 GGAGTTTTACTCATGGTGGAAGG + Intronic
1052316720 9:27123141-27123163 GCATTTTTAGTGAATGGGCAGGG + Intronic
1052622107 9:30925754-30925776 GCATTTTTACTCATGGCAGAAGG + Intergenic
1058935557 9:109766568-109766590 GCATCTTTATTTATTGTGCATGG + Intronic
1060505332 9:124193497-124193519 GAACTTTTACTCATGGTGGAGGG - Intergenic
1062261930 9:135667194-135667216 GCATTTTTGCTGCACGTGCAGGG - Intergenic
1185878728 X:3721476-3721498 GTATTTTTAATTACGGTGCAAGG - Intergenic
1189131274 X:38500323-38500345 ACATTTCTATTCATGGTGCAGGG + Intronic
1192581904 X:72290280-72290302 ACATTTTTAGTGATGGTGAATGG + Intronic
1193783851 X:85735149-85735171 TCAGTTTTACAGTTGGTGCAGGG + Intergenic
1194582600 X:95695101-95695123 GCAATTTTATTGATGGGGGAAGG - Intergenic
1195982206 X:110591201-110591223 TCAGTTTTTATGATGGTGCAGGG - Intergenic
1196662898 X:118286581-118286603 GCATTTCTGCTGATGATGAATGG + Intergenic
1197343263 X:125300211-125300233 GTATTTATACAGATGCTGCAGGG + Intergenic
1197788273 X:130222836-130222858 GTATTTTTAGAGATGGGGCAGGG + Intronic
1199676153 X:150190875-150190897 GCATCCATTCTGATGGTGCAGGG - Intergenic
1201797327 Y:17911384-17911406 GCATTTTTACATGTGGTGGAGGG + Intergenic
1201804226 Y:17994601-17994623 GCATTTTTACATGTGGTGGAGGG - Intergenic
1201863058 Y:18620814-18620836 TCATTTTTACAGCTGGAGCAAGG + Intergenic
1201870265 Y:18699564-18699586 TCATTTTTACAGCTGGAGCAAGG - Intergenic