ID: 1156951730

View in Genome Browser
Species Human (GRCh38)
Location 18:42908689-42908711
Sequence ATGTCTTTATTTCAGTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156951730_1156951731 -10 Left 1156951730 18:42908689-42908711 CCTTCATACTGAAATAAAGACAT 0: 1
1: 0
2: 2
3: 38
4: 337
Right 1156951731 18:42908702-42908724 ATAAAGACATTCTCAGTTGAAGG 0: 1
1: 16
2: 67
3: 167
4: 436
1156951730_1156951732 -9 Left 1156951730 18:42908689-42908711 CCTTCATACTGAAATAAAGACAT 0: 1
1: 0
2: 2
3: 38
4: 337
Right 1156951732 18:42908703-42908725 TAAAGACATTCTCAGTTGAAGGG 0: 1
1: 0
2: 5
3: 41
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156951730 Original CRISPR ATGTCTTTATTTCAGTATGA AGG (reversed) Intronic
903444592 1:23413846-23413868 ATGTATTCATTTCAGTAGCAAGG - Intronic
904292245 1:29495272-29495294 ATTTATTTAAATCAGTATGAAGG + Intergenic
905080010 1:35310255-35310277 ATGTCTTACTTTTATTATGAAGG + Intronic
905194269 1:36262590-36262612 ATGTCTGTATATCAGTATGGGGG + Intronic
905714402 1:40135581-40135603 CTGTCTTTATGCCAGTATCACGG - Intergenic
907479051 1:54731401-54731423 GTTTCTTTATTTCAGTAAAATGG + Intronic
908732117 1:67236860-67236882 ATGTGATTTTTTCAGTATGATGG - Intronic
909299215 1:73989928-73989950 ATGTATTTATTTGTGTATGGTGG + Intergenic
910415487 1:86992815-86992837 AGGTCTTCATTTCCTTATGAAGG - Intronic
910513637 1:88035509-88035531 AGGTCTTCATATCAGTCTGAAGG - Intergenic
910606442 1:89090310-89090332 GTCTGTTTATTTCAGTATTAAGG + Intergenic
911419487 1:97621987-97622009 ATTTATTTATATAAGTATGATGG - Intronic
915228696 1:154429954-154429976 AAGTCTTTATCTAGGTATGAGGG - Intronic
916202600 1:162286176-162286198 ATGTTTTTATCTCATTAGGATGG + Intronic
916573223 1:166045342-166045364 ATGTCTTCCTTTCTGTAGGAGGG + Intergenic
917300243 1:173565847-173565869 ATGTCTTTTTTTTATCATGAAGG + Intronic
917993314 1:180406623-180406645 ATGTATTTATTTCAATGTGTGGG + Intronic
918470767 1:184870787-184870809 ATGTCTTTTCTTCAGTAAGAGGG - Intronic
918957431 1:191227674-191227696 ATGTCTTTATATGACTATTAGGG + Intergenic
919579759 1:199357054-199357076 CTGTCTTTTTTTCAGTATGGGGG - Intergenic
922146882 1:222955253-222955275 ATTTTTTTATTTTAGTAGGACGG + Intronic
923072227 1:230576388-230576410 GGGTCTTTATTTCCTTATGAAGG + Intergenic
923261823 1:232275050-232275072 GAGTCTTTATTTCCTTATGAAGG - Intergenic
1063774755 10:9250044-9250066 ATGACTATATTTCAGTAAGTTGG + Intergenic
1065578127 10:27144355-27144377 TTGCCTTTATTTCAGTGTAAGGG - Intronic
1066230428 10:33427067-33427089 ATGTCTTTTGTTCATTATGTTGG - Intergenic
1066386958 10:34949171-34949193 ATGTCTTTATCTCACAATAAAGG + Intergenic
1068031645 10:51712055-51712077 AGGTCTTCATTTCCTTATGAAGG - Intronic
1068217944 10:54008390-54008412 ATCCCTTTATTTCAATATGGGGG - Intronic
1068906576 10:62332375-62332397 ATGTTTTTATTTCTGCCTGAAGG + Intergenic
1069185509 10:65417748-65417770 AGGTCTTCATTTCCTTATGAAGG + Intergenic
1069665253 10:70150940-70150962 ATGTCTTTATTCTAATGTGAGGG - Exonic
1070718334 10:78738857-78738879 ATGTCTTTATTCCACTGTGGAGG - Intergenic
1071096512 10:81981605-81981627 CTTTCTTGATTTCAGAATGAGGG - Intronic
1071321244 10:84460451-84460473 CTGTCTTTGTTTTAGTATCAGGG + Intronic
1071913223 10:90259374-90259396 CTGTCTGTATTTAAGAATGATGG + Intergenic
1071933073 10:90495981-90496003 ATGTCTTTGTTCCAGAATGAAGG + Intergenic
1071934094 10:90507399-90507421 ATGTCTTTGTCTCAGTGTGCAGG - Intergenic
1072284476 10:93899812-93899834 ATATCTTTATTTCAAAATGGGGG - Intronic
1073219609 10:101859454-101859476 ATTTATTTATTTCAGTGTCAGGG - Intronic
1073385368 10:103122937-103122959 AGGTCTTCATTTCCTTATGAAGG + Intronic
1073388457 10:103149394-103149416 ATTTCTTCATTTGAGAATGAAGG - Intronic
1074142324 10:110684795-110684817 ATGTGTTTATTTCACTATCTGGG + Intronic
1074247129 10:111706094-111706116 ATGTCATTATTTCCATCTGATGG + Intergenic
1075484456 10:122810781-122810803 ATGTTTTTAATTCAGGAAGATGG + Intergenic
1075541779 10:123319588-123319610 ATGCCTTTTTTACAGCATGATGG - Intergenic
1077941214 11:6845739-6845761 ATGACTGTATTTCAGTAGGTAGG - Exonic
1077943468 11:6869769-6869791 ATGACTGTATTTCAGTAGGCAGG - Exonic
1079170877 11:18094393-18094415 ATGTGTGGATTTCAGTATGGGGG + Intronic
1079175883 11:18140001-18140023 ATGTCTTTAGTTCAGACTGAGGG + Intronic
1079179436 11:18176080-18176102 ATGTCTTTAGTTCAGACTGAGGG + Intronic
1079265827 11:18932004-18932026 ATGTCTTCAGTTCAGGCTGAGGG - Intergenic
1080967684 11:37232559-37232581 AGGTCTTTATTTCCTGATGAAGG - Intergenic
1085093664 11:73741070-73741092 ATGTCTCTATTTCATCATGCTGG - Intronic
1085429173 11:76432168-76432190 GGGTCTTTATTTCCTTATGATGG - Intergenic
1085980757 11:81721191-81721213 AGGTCATTATATCAGGATGAAGG + Intergenic
1087168791 11:95029610-95029632 ATTTCATTATTTGAATATGATGG - Intergenic
1087924901 11:103908613-103908635 ATGTCTATATTTCAAAAAGACGG + Exonic
1088753066 11:112861862-112861884 ATGTCTTTCTTTAATTCTGAGGG + Intergenic
1090369688 11:126240212-126240234 ATGTCTTTATTTAGGTATGTAGG + Intronic
1093254430 12:16849327-16849349 ATCTCTTTATTTCATCAAGAAGG - Intergenic
1093261094 12:16939190-16939212 TTGTCTTCATTTTTGTATGATGG + Intergenic
1093397740 12:18704327-18704349 CTTTCTTTTTTTCAATATGAAGG + Intronic
1093518382 12:20018472-20018494 ATGTCATTCTTTCATTGTGATGG + Intergenic
1093780170 12:23126509-23126531 GTGTCTTCATTTCCTTATGAGGG + Intergenic
1095173166 12:39058670-39058692 AGGTCTTTATTTATTTATGAGGG + Intergenic
1095384180 12:41630729-41630751 ATCTCTTTATTTTATTCTGAAGG - Intergenic
1095558829 12:43540954-43540976 ATGTTCTTATTTCAGTATCATGG + Intronic
1095813927 12:46400858-46400880 ATGTCTTTAAGTCGGTAAGAAGG + Intergenic
1095839774 12:46680462-46680484 ATGTCTTTATTTGACACTGAGGG + Intergenic
1097709721 12:62904667-62904689 ATGTCTTTATTTCACTTCAAGGG - Intronic
1097713802 12:62943630-62943652 TTGTCTTTATTTCCTTATGAAGG + Intergenic
1099289586 12:80760467-80760489 AGGTCTTTATTTCCTTAGGAAGG - Intergenic
1099393475 12:82108841-82108863 ATGTCTTTGTTTCATTAAGAAGG - Intergenic
1099445216 12:82743914-82743936 ATGTTTTAATTTTTGTATGATGG + Intronic
1099473367 12:83077465-83077487 ATGTCTTCAATTCTATATGAAGG + Intronic
1099703294 12:86117243-86117265 ATGCAATTTTTTCAGTATGAAGG - Intronic
1100692378 12:97052117-97052139 GGGTCTTTCTTGCAGTATGAAGG + Intergenic
1100729115 12:97444067-97444089 ATGCCTTTATGTCATTATTATGG - Intergenic
1101121537 12:101585533-101585555 ATGTCTTTAATACATTAAGATGG - Intronic
1101714692 12:107300592-107300614 ATGACTCTAGTTCAGTGTGACGG - Intergenic
1104495673 12:129235689-129235711 ATGTCTTCATTTCTTTTTGAAGG + Intronic
1105611976 13:21976745-21976767 GGGTCTTTATTTCTTTATGAAGG - Intergenic
1107191751 13:37596366-37596388 AAGTCTTTATTTTACAATGAGGG - Intronic
1107384595 13:39894300-39894322 GTGTCTCTATTTCCTTATGAAGG - Intergenic
1107478835 13:40768177-40768199 ATGTGTTAGTTTCAGTAAGAGGG + Intronic
1107925086 13:45251694-45251716 AAGAATTTATTTCAGTAAGAAGG - Intronic
1108116671 13:47136177-47136199 ATTTCTTTTTTGCAGTATCATGG - Intergenic
1108550091 13:51535480-51535502 ATGTCTTTATAAAAGTAAGAGGG + Intergenic
1108621685 13:52191127-52191149 ATGTGTTGGTTTCAGTAAGAGGG + Intergenic
1108665054 13:52621060-52621082 ATGTGTTAGTTTCAGTAAGAGGG - Intergenic
1108936625 13:55890368-55890390 ATGTTTATATTTCAAAATGATGG + Intergenic
1109639518 13:65171177-65171199 ATGTCTTCCTTTCATCATGACGG + Intergenic
1109900463 13:68762634-68762656 AGGGCTTTATTTCATTTTGAAGG + Intergenic
1110729446 13:78863132-78863154 ATGTATTTCTTTCAGTTTGTGGG + Intergenic
1111336455 13:86831028-86831050 ATATATTGATTTAAGTATGAAGG + Intergenic
1111427459 13:88106196-88106218 ATGTCTTTATTTAATTATAAAGG - Intergenic
1112573034 13:100611200-100611222 ATACCTTTATTTCAGAATCAGGG - Intronic
1112885824 13:104170174-104170196 ATGTAATTATTTCAGTTTCATGG - Intergenic
1113240760 13:108334631-108334653 ATGTCATTATTTCATTTTCATGG - Intergenic
1114505543 14:23209519-23209541 ATTTGTTTATATCAGTATGGAGG - Intronic
1115164985 14:30438164-30438186 ATGTTTTTATTTCAGAACTAAGG - Intergenic
1115271457 14:31558080-31558102 ATGTTTTTATATCACTATGTAGG + Intronic
1116006001 14:39291004-39291026 GTTGCTTTGTTTCAGTATGAAGG + Exonic
1116102639 14:40461388-40461410 ATGTTTCAATTTCAGTCTGAAGG + Intergenic
1119354074 14:73990677-73990699 ATGGCTTTGTTGCAGAATGATGG - Intronic
1120008204 14:79383970-79383992 GTGTTTTTATTTCATTATGCTGG + Intronic
1120016194 14:79476439-79476461 ATGAATTGATTTCAGGATGAAGG - Intronic
1120397522 14:83986459-83986481 AGGTCTTCATTTCTTTATGAAGG + Intergenic
1120450356 14:84658597-84658619 ATGTTATTATTTTATTATGAAGG - Intergenic
1120511952 14:85425997-85426019 ATGTCTATAATTTAGTCTGATGG - Intergenic
1122377387 14:101272519-101272541 TTGTCTTCATTTCAGTAAGTTGG + Intergenic
1123670771 15:22654612-22654634 ATCTCTGTATTACAGTATAACGG - Intergenic
1124159844 15:27258240-27258262 ATTACCTTATTTCAGTATCATGG + Intronic
1124784727 15:32668947-32668969 ATGTCTTTATTTCTGCCTGCAGG + Intronic
1125061429 15:35430383-35430405 TTTTTTTTTTTTCAGTATGAAGG - Intronic
1126754782 15:51915369-51915391 ATGTCTTTTTTTCAGTTTTTTGG + Exonic
1127512986 15:59661388-59661410 ATGTCTTTATCTCTTTATAAAGG + Exonic
1127748898 15:62011578-62011600 TTTTCTTTATTTCAGTTTCATGG - Intronic
1127919706 15:63484203-63484225 ATGTTTTTATTCCAGCAAGAAGG - Intergenic
1129497852 15:76003939-76003961 ATATCTTTATTTCACCATGTAGG - Intronic
1130003031 15:80064412-80064434 ATTTCTTTAATTAATTATGATGG + Intronic
1130799376 15:87245797-87245819 ATGTCTTTGTTTCACTCTGACGG + Intergenic
1130851354 15:87797247-87797269 ATTTGTTTTTTTCAGTGTGAGGG - Intergenic
1131198209 15:90373976-90373998 AAAGCTTTATTTCAGTATCATGG - Intergenic
1135727294 16:24865774-24865796 ATGTCTTTATTTCAGCCTGAAGG - Intronic
1138875033 16:60938820-60938842 CTGCCTTCATTTCATTATGAAGG - Intergenic
1139003648 16:62544452-62544474 ATGTCTAAAATTCAGTATCAAGG - Intergenic
1139163864 16:64542709-64542731 ATATTTTTATTTCTGTCTGAAGG - Intergenic
1139258416 16:65566420-65566442 ATGTATTGATTTCAGAATTATGG + Intergenic
1140125930 16:72119110-72119132 ATGTCTTTATTTCAGAGTTTGGG + Exonic
1140199687 16:72885153-72885175 TTGTCTTTGGTTCAGTGTGATGG - Intronic
1141216552 16:82030580-82030602 ATGTATTTATATCACTATGGAGG + Intergenic
1147216729 17:38904216-38904238 ATATCTTTATTTAATTATGAGGG + Intronic
1147519153 17:41152269-41152291 CTGTTTTTATGTCAGAATGATGG + Intergenic
1149576131 17:57714916-57714938 ATGTGTTTATTTGAATACGAAGG + Intergenic
1149945758 17:60924385-60924407 TTGTCTTTATTTCTTTGTGAAGG + Exonic
1150175224 17:63047846-63047868 AGGTCTTCATTTCCTTATGAAGG - Intronic
1152518736 17:80842569-80842591 ATGTATTTATTTGGCTATGATGG + Intronic
1153052566 18:913959-913981 ATGTATTTATTACTGTATGCAGG - Intergenic
1153256191 18:3173852-3173874 ATGCATTTATTTCAGCATTATGG + Intronic
1154315286 18:13299206-13299228 ATGTGTCTATTTCAGAAAGAGGG - Intronic
1155076974 18:22366927-22366949 ATGCCTGTCTTTCAGTAAGAAGG + Intergenic
1156587044 18:38442808-38442830 ATGGCTCTATTTCAGAATGTAGG - Intergenic
1156951730 18:42908689-42908711 ATGTCTTTATTTCAGTATGAAGG - Intronic
1157481426 18:48057140-48057162 ATGTCTTTAATGCTGAATGATGG - Intronic
1158220017 18:55140712-55140734 ATGTCGGGATTTCAGAATGAGGG + Intergenic
1158806514 18:60980160-60980182 ATGGCTTTCTTCCAGTGTGAGGG + Intergenic
1159269914 18:66135271-66135293 ATATGTTTGTTTCAATATGATGG + Intergenic
1159312389 18:66726064-66726086 ATGTATTTATTTTAGGATGGTGG + Intergenic
1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG + Intergenic
1165986412 19:39772949-39772971 ATGTCATTATCTCAGTATCTCGG - Intergenic
925596499 2:5560749-5560771 ATGACTTTTTCTCATTATGATGG + Intergenic
928663258 2:33525216-33525238 ATGACTTTATTTCAGGAGGTAGG - Intronic
928707139 2:33962281-33962303 ATCTCATTATTTCTGTAAGAAGG + Intergenic
929324228 2:40587627-40587649 ATATCTTTCTTTTATTATGATGG - Intronic
929707559 2:44229690-44229712 ATATCTTTATTTTAGTCTGTCGG + Intronic
930431923 2:51288849-51288871 CTCTCAGTATTTCAGTATGATGG + Intergenic
930746438 2:54888092-54888114 AAGACTTTATTGCAGTTTGACGG + Intronic
930759276 2:55014890-55014912 ATGTCTTCATTTAAGTATCCAGG + Intronic
931231668 2:60380319-60380341 ATGTCTTTATATCAGAAGTAGGG - Intergenic
931369765 2:61651246-61651268 AGGTCTTTATTTCTTTATGAGGG - Intergenic
931370153 2:61654857-61654879 AGGTCTTTATTTCTTTATGAGGG - Intergenic
931943462 2:67278812-67278834 ATGTCTATATTTCATTAATATGG + Intergenic
932851703 2:75193951-75193973 ATATCTTTATCTAAGTTTGATGG + Intronic
933537630 2:83596599-83596621 ATGTGCATATTTCAGTATGTAGG - Intergenic
934017390 2:87902693-87902715 CTGTATTTATTTCAGTGTAAAGG - Intergenic
935334570 2:102004554-102004576 ATTTCTTTCTTCCAGTAAGAAGG + Intronic
936583576 2:113729635-113729657 ATATCTTTATATCAATATAAAGG - Intronic
937381616 2:121382610-121382632 GTGTGTATATGTCAGTATGAGGG + Intronic
937731741 2:125240692-125240714 AAGTATTTATTTGAGTATTATGG + Intergenic
939448179 2:142336313-142336335 GTGTCTTTATTTTCTTATGAGGG - Intergenic
939767613 2:146271196-146271218 ATGTCTTAATTTATATATGATGG + Intergenic
940309633 2:152264007-152264029 ATGTTATGATTTCAATATGATGG + Intergenic
940879698 2:158934542-158934564 ATGGATTTATTGCAGGATGAGGG + Intergenic
941252441 2:163182874-163182896 ATGTTTCTATTTTAGTAAGACGG - Intergenic
943471349 2:188297652-188297674 TTGTCTTTATTTCTATAAGAGGG - Intronic
943990643 2:194686810-194686832 GTTCCTTTATTTCACTATGAGGG + Intergenic
945248676 2:207744676-207744698 AAGTTTTTATTCCAGTTTGATGG + Intronic
945578938 2:211568358-211568380 ATATCTCTATTTCAGCCTGAAGG + Intronic
1169642248 20:7766523-7766545 ATACTTTTATTTCAGTCTGAAGG - Intergenic
1169750536 20:8988135-8988157 ATGTCTTTAATTTAGTGGGAGGG + Intergenic
1169982732 20:11404824-11404846 AGGTCTTTATTTCTTTATGAGGG - Intergenic
1170340995 20:15327065-15327087 AGGTCTTCATTTCCTTATGAAGG - Intronic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1173050380 20:39553683-39553705 ATTTCTTTATTTCACCATCAAGG - Intergenic
1173639400 20:44589923-44589945 ATATCTTTATTTCTGGTTGAAGG + Intronic
1177293292 21:19142995-19143017 GAGTCTTTATTTCATTATGATGG + Intergenic
1177385165 21:20399303-20399325 AAGTCTTTTTCTCAGTATGCAGG - Intergenic
1177403913 21:20641512-20641534 TTGTCTGTATTTCATTCTGATGG - Intergenic
1177554786 21:22675297-22675319 ATGTCTCTATCTCAGTCTAAGGG + Intergenic
1178261231 21:31101638-31101660 AGGTCTTTATTTCCTAATGAAGG - Intergenic
1178782499 21:35617439-35617461 ATGTATTTATTTAAGTCTTATGG - Intronic
1179835252 21:44027614-44027636 ATGTCTTGGTTTCCATATGAGGG + Intronic
1181798798 22:25330204-25330226 ATGTCTTCATTTCATTAATAAGG - Intergenic
1181900762 22:26153830-26153852 CTGTCTATATTTGAGTAGGATGG - Intergenic
1183602598 22:38848708-38848730 ATGACTTTATTACAGTCTAAAGG - Intergenic
1184862801 22:47184431-47184453 ATGTCTTTGTTTTGGTATCAGGG - Intergenic
1184990184 22:48162276-48162298 ATGTATTTATTTCAGAGAGAAGG - Intergenic
949559810 3:5190541-5190563 TGGCCTTTATTTCAGGATGAAGG + Intronic
949915465 3:8959909-8959931 ATCTTTTCATATCAGTATGATGG - Intronic
952271529 3:31837101-31837123 AGGTCTTTATTTAATTGTGAAGG - Intronic
952551393 3:34482515-34482537 ATGCTTTTACTTCAGGATGAAGG + Intergenic
954742308 3:52763188-52763210 AGGTCTTCATTTCCTTATGAGGG + Intronic
955566153 3:60249055-60249077 ATGTCTTCATTTCCTAATGAGGG + Intronic
957017029 3:75078412-75078434 CTTTCTGTATTTCAGTGTGATGG + Intergenic
957280358 3:78143704-78143726 ATGAATTGAATTCAGTATGAGGG + Intergenic
957326521 3:78702691-78702713 ATGCCATTATTTCAGAATGTTGG + Intronic
957346958 3:78973342-78973364 AGGTCTTTTTTTCAGTACAAAGG - Intronic
957398408 3:79675968-79675990 GGGTCTTTATTTCCTTATGAAGG + Intronic
957407989 3:79796561-79796583 ATGGTTTTCTTTCAGTCTGAAGG - Intergenic
957641491 3:82859795-82859817 CTGTCTTGAGTTCTGTATGAAGG + Intergenic
957662299 3:83175870-83175892 TTGTGTTTATTTTATTATGACGG - Intergenic
959411855 3:106034083-106034105 GTGTCTTTATTTTATTCTGAGGG - Intergenic
959437834 3:106338810-106338832 ATGGCTTTATTTCAGTGGCATGG + Intergenic
959480813 3:106870839-106870861 AGGCCTTTATTTCCTTATGAAGG - Intergenic
960371801 3:116850050-116850072 ATGTGTCTATTTGTGTATGAGGG - Intronic
961726388 3:128933652-128933674 ATGGCTTTATTTCTGTCTGAGGG - Intronic
963209009 3:142667795-142667817 ATGTGTGTATTTCAGAATTATGG + Intronic
963220880 3:142810921-142810943 AAGTATTTATTTCAGTCTGGGGG - Intergenic
963947274 3:151160243-151160265 ATGTTTTTATTTCCCTGTGATGG + Intronic
964417570 3:156463537-156463559 TTGTCTTTATTTCAGTGAGATGG + Intronic
964574601 3:158151187-158151209 ATGTCTTCATTTCCTTATGAAGG - Intronic
965002601 3:162974722-162974744 AAGTCTTCATTTCCTTATGAAGG - Intergenic
965183716 3:165436654-165436676 GTGTCTTCATTTCTTTATGAAGG - Intergenic
965453772 3:168872063-168872085 ATTTCTTTATATCATCATGAAGG - Intergenic
965519839 3:169661393-169661415 ATGTCTTTATTTTCATCTGAAGG - Intronic
965996438 3:174888323-174888345 ATGTCATTATTTCACTTTGTAGG - Intronic
967085173 3:186088412-186088434 AGGCCTTCATTTCAGGATGATGG - Intronic
969864480 4:10065136-10065158 AGGACTTTATTTCCTTATGAGGG + Intergenic
971773460 4:30929323-30929345 TTGTCTATATTTCAGTATAAAGG - Intronic
971809923 4:31411766-31411788 CTGGCTTTATTCCAGTAAGAAGG + Intergenic
971825121 4:31611230-31611252 ATATTTTTATGTAAGTATGAGGG - Intergenic
972770788 4:42195084-42195106 ATGACTTACTTTCTGTATGATGG + Intergenic
972998061 4:44907717-44907739 ATTTCTGTATTTCTGTATAAAGG - Intergenic
973575720 4:52287045-52287067 ATGTCCCAATTTCAGGATGAAGG + Intergenic
973607799 4:52605140-52605162 ATTTCTTTAGTTCACTAAGAGGG - Intronic
974489608 4:62548013-62548035 AGGTTGTTCTTTCAGTATGAAGG + Intergenic
974849757 4:67390344-67390366 AGGTCTTCATTTCCTTATGAAGG + Intergenic
974861734 4:67530725-67530747 ATGTGTTGCTTTGAGTATGAAGG - Intronic
975026488 4:69555399-69555421 ATTTTTATATTTCAGTATAAAGG - Intergenic
979062718 4:116084110-116084132 ATGTATTTATTTCTGTATCTAGG - Intergenic
979579764 4:122343238-122343260 AAGTCTTTATTTCAGTTTTAAGG + Intronic
979582413 4:122376398-122376420 ATTTCATTATATCAGTATGGAGG - Intergenic
979660605 4:123249983-123250005 ATGTTTTTATTAAAGTATAAAGG + Intronic
979823499 4:125203620-125203642 AGGTCTTCATTTCCTTATGAAGG - Intergenic
980145592 4:128979526-128979548 ATGTATTTATTACAGTCTGGAGG - Intronic
981742978 4:148022434-148022456 ATGACTTTATTGAAGAATGAAGG + Intronic
981781198 4:148431655-148431677 TTGTCTTTATTTCAGTCTGTGGG - Intronic
982494975 4:156079115-156079137 ATATCTTTGTTTTAGTATCAGGG + Intergenic
984504578 4:180600778-180600800 ATATCATTAATTCAGTATGCAGG + Intergenic
986588388 5:9343217-9343239 GTGTCTTTATGTAAGTATGGAGG + Intronic
987128634 5:14839627-14839649 TAGTCTTGATTTCAGTCTGAAGG - Intronic
987261451 5:16207915-16207937 AGATCTTTATTTCCTTATGAAGG + Intergenic
988836867 5:35041679-35041701 ATGTCTCTTTCTCAGCATGAAGG + Intronic
990082400 5:51933263-51933285 AAATCTTTATTTTAATATGATGG + Intergenic
990224454 5:53633592-53633614 GGGTCTTCATTTCCGTATGAAGG + Intronic
990376378 5:55174293-55174315 TTTTCTTGCTTTCAGTATGAAGG - Intergenic
990979957 5:61593383-61593405 ATGTTTCCATTTCAGTCTGAAGG + Intergenic
991658373 5:68926127-68926149 AGGTCTTCATTTCCTTATGAGGG - Intergenic
992980983 5:82171689-82171711 ATGGATTTATGTGAGTATGAGGG + Intronic
993100474 5:83532549-83532571 ATTTCTTAATATCAGTTTGAAGG - Intronic
993838466 5:92845472-92845494 TTTTCTTTATTTCAGTATAATGG - Intergenic
995843290 5:116466021-116466043 ATCTCCTTCTTTCAGTTTGAGGG - Intronic
996558217 5:124800499-124800521 AGGTCTTCATTTCCGTATGAAGG - Intergenic
998824498 5:146087356-146087378 ATGTTTTTATTTCATTTGGATGG + Intronic
999774969 5:154804759-154804781 TTTTATTTATTTCAGTAAGATGG + Intronic
1000506698 5:162128780-162128802 CTGTTATTATTTCAGTATCATGG + Intronic
1001210098 5:169803043-169803065 CTGTCTTTATTCCAGAATGCCGG + Exonic
1001826051 5:174745958-174745980 ATGTTTTCATTGCAGTGTGATGG - Intergenic
1003697494 6:8424856-8424878 ATGTACTTATTCCAGTATGTCGG + Intronic
1003756511 6:9126874-9126896 AAGGCTGTATTTCAGTGTGAAGG + Intergenic
1003822675 6:9917297-9917319 ATTTCTGTATTTCAGTAAAAAGG + Intronic
1004439908 6:15640321-15640343 GTGTCTTTATCTCAGTAAAATGG - Intronic
1005601388 6:27429905-27429927 GGGTCTTTATTTCCTTATGAAGG - Intergenic
1006606638 6:35262030-35262052 AGGTCTTCATTTCCTTATGAAGG - Intronic
1008901425 6:56622022-56622044 TTTTCTTTATTTTAGTATCAGGG + Intronic
1009328995 6:62391708-62391730 ATGTGTTGATTTCATTATGGAGG - Intergenic
1010069162 6:71723185-71723207 GAGTCTTTATTTCCTTATGAAGG - Intergenic
1010338572 6:74720616-74720638 CTGTCTTTATTTTATTTTGAAGG + Intergenic
1010558219 6:77312700-77312722 CAGTCTCTATTTCAGTATAAAGG - Intergenic
1011713328 6:90077508-90077530 ATGTCTTTATTCCAGACTGATGG + Intronic
1012283508 6:97359854-97359876 AAGTCTTCATTTGAGTTTGATGG + Intergenic
1012821071 6:104085049-104085071 ATGTCTTTATTTGAAGATTATGG + Intergenic
1013286316 6:108685204-108685226 ATGTCTGACTTTCAGTATGCAGG - Intergenic
1013457779 6:110346831-110346853 TTGTATTTTTTCCAGTATGATGG + Intronic
1014429049 6:121344246-121344268 TTGTTTTTATTTCATTCTGATGG + Intergenic
1014515333 6:122370947-122370969 ATGTAATTATTTCAAAATGAAGG + Intergenic
1014906201 6:127031439-127031461 ATTTCTTTCTTTCACAATGATGG - Intergenic
1015535255 6:134260939-134260961 GTATTTTTATGTCAGTATGATGG + Intronic
1015826032 6:137312779-137312801 AGGTCTTCATTTCCTTATGAAGG + Intergenic
1017397464 6:154018959-154018981 ATTTTTTAATTTCAGTTTGATGG + Intronic
1017932390 6:158969146-158969168 ATCCTTTCATTTCAGTATGAAGG + Intergenic
1018530501 6:164757946-164757968 ATAACTTTATTACAGTCTGATGG + Intergenic
1019868586 7:3737092-3737114 ATGTCTTTCTTTCCTTATGGCGG + Intronic
1020806680 7:12798504-12798526 ATCTCTATATTTAAATATGAGGG + Intergenic
1023542303 7:41278829-41278851 CTTTATTTATCTCAGTATGATGG - Intergenic
1023683009 7:42706922-42706944 GTCTCTTTATTTCCGTAAGATGG + Intergenic
1024437388 7:49375284-49375306 ATTTCTTAATATCAGTATTACGG - Intergenic
1025750029 7:64285733-64285755 ATGAGTTTATACCAGTATGAAGG - Intergenic
1027406070 7:77862242-77862264 ATGTCTTTTTTACAGTGTTAAGG + Intronic
1027438074 7:78187733-78187755 ATGTCCTTTTGTCTGTATGAGGG + Intronic
1027713625 7:81641143-81641165 ATGTCTTTACTTGCATATGAAGG + Intergenic
1027795363 7:82686561-82686583 ATGTCTTTTTTTCATTTTGTTGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027819170 7:83021630-83021652 ATGTTTTTATTTCTATATGCTGG - Intronic
1027819231 7:83022265-83022287 ATGTATTGCTTTCAGTTTGAAGG - Intronic
1028552579 7:92086479-92086501 GAGTCTTAATTTAAGTATGAAGG + Intronic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1030124008 7:106137618-106137640 AGGTCTTCATTTCCTTATGAAGG + Intergenic
1031216035 7:118892569-118892591 ATGTATTTTTTTCAGCATTATGG - Intergenic
1031821928 7:126512813-126512835 ATGTCTTTATTCCATCAGGAAGG + Intronic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1034333638 7:150305905-150305927 ATGTCTTCAATTCACTTTGATGG + Intronic
1035149080 7:156851754-156851776 ATGTGCTTATTTCAGAATGGTGG + Intronic
1036768407 8:11563336-11563358 TTGTCTTGATTTCAGTTTGAGGG - Intronic
1038303887 8:26382506-26382528 TTCTCTTTTTTTCAGAATGATGG + Intergenic
1038996827 8:32932565-32932587 ATGACTTCATTTCCTTATGAAGG - Intergenic
1041328139 8:56691719-56691741 ATGTCTGTTTCTCAATATGATGG - Intergenic
1041880274 8:62741717-62741739 GTGTTTTTATTTCCTTATGATGG + Intronic
1042106382 8:65331819-65331841 ATGTATGTATTTGAGTGTGATGG + Intergenic
1042204068 8:66310780-66310802 ATGTATTTATTTCTTTATTATGG - Intergenic
1043171034 8:76967058-76967080 ATATTTTTTTTTCAGTATGTTGG - Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1043620748 8:82189859-82189881 ATGGCCATATTTCATTATGAGGG + Intergenic
1043761383 8:84073129-84073151 ATGTATTTTTTGCAGTTTGAGGG + Intergenic
1044034169 8:87277178-87277200 ATGTCCAAGTTTCAGTATGATGG + Intronic
1044130502 8:88517757-88517779 ATGTGATTATTTATGTATGATGG + Intergenic
1044162532 8:88936901-88936923 ATGTATTTATGGCATTATGAAGG - Intergenic
1044358686 8:91256526-91256548 CTGTCATCATTTCAGCATGAAGG - Intronic
1044366585 8:91354505-91354527 ATGACTTGATTTCATTATGAAGG + Intronic
1044393810 8:91685059-91685081 ATGTCATTATTTAATTATCAAGG + Intergenic
1045595665 8:103651819-103651841 ATGCCTTTACTTCAATATTAAGG + Intronic
1045611207 8:103844600-103844622 GTGGCTTTATTTCTATATGATGG - Intronic
1045852658 8:106721546-106721568 ATGTCTTTTTATCAGTATTTTGG - Intronic
1045943821 8:107771232-107771254 ATGTCTTTAACTCGGTAAGAAGG + Intergenic
1046503012 8:115102751-115102773 ATAAATTTATTTCAATATGAAGG + Intergenic
1046642250 8:116745329-116745351 TTCTCTTTATTACAGTAGGAAGG + Intronic
1047141560 8:122146581-122146603 AAGTATTTATTTCAGATTGAAGG + Intergenic
1047995190 8:130328396-130328418 CTGTATTAATTTCAGGATGAGGG + Intronic
1048112550 8:131484562-131484584 ATGTCTGTATTTCAGAAGGAGGG + Intergenic
1050281234 9:4052199-4052221 AGTTCTTTATTTCAGGAGGATGG - Intronic
1050786303 9:9406486-9406508 ATGTCTTGATTTCAGTGAAAAGG - Intronic
1051212155 9:14756515-14756537 ATGAGTTTAGTCCAGTATGAGGG - Intronic
1051316967 9:15848309-15848331 AACTTTTTATTTCATTATGAAGG + Intronic
1051373096 9:16374881-16374903 ATGTGTTAATTTCAGTATGAAGG - Intergenic
1051395468 9:16615662-16615684 AAGTCTTCATTTCCTTATGAAGG + Intronic
1052524082 9:29590496-29590518 ATTTTTTTTTTTCAGTGTGAAGG + Intergenic
1052812698 9:33075597-33075619 ATGTATTCATTTCTGTTTGAAGG - Intronic
1054955711 9:70907556-70907578 ATGTCTTTATTTTAGATTCAAGG + Intronic
1055533515 9:77212138-77212160 AGATCTTTATTTCAGAAAGATGG - Intronic
1055697068 9:78896714-78896736 ATGTGTTTCTTTCAGTATCTGGG - Intergenic
1058214348 9:102215595-102215617 ATAACTTTGTTTCAGTATGAAGG + Intergenic
1058546805 9:106069328-106069350 TTTTATTTATGTCAGTATGAAGG - Intergenic
1058711472 9:107682863-107682885 ATGTGTATATTTCATTATGAGGG + Intergenic
1058974266 9:110111436-110111458 ATGTCATCATTTCAGTAACATGG - Intronic
1059461787 9:114435568-114435590 TTTTCTTTCTTTCAGAATGAGGG - Intronic
1061624374 9:131832962-131832984 ATGTGTTCATTTCCTTATGAGGG + Intergenic
1203734181 Un_GL000216v2:120073-120095 ATGTCTTTATTTCCTTACAAAGG + Intergenic
1185499368 X:585225-585247 ATGTCTTTATTACGGTGGGATGG - Intergenic
1186136133 X:6523459-6523481 TTGTCTTTATTTCTCTCTGATGG - Intergenic
1187088257 X:16065151-16065173 AGGTATTTATTTCCTTATGAAGG + Intergenic
1189399696 X:40655896-40655918 ATGTATTTTTTTCAGTCTTACGG - Intronic
1189411145 X:40772571-40772593 ATGTCTGCATTTCAGGCTGAAGG - Intergenic
1190394959 X:49972800-49972822 ATGTCTTCAATTCTGTATGTTGG - Intronic
1191636257 X:63380615-63380637 AGGTCTTCATTTCATCATGAAGG - Intergenic
1191888001 X:65909058-65909080 GTGTCTTCATTTCAGCATGAAGG + Intergenic
1191939811 X:66466399-66466421 AAGTCTTCATTTCCTTATGAAGG - Intergenic
1193911100 X:87308031-87308053 ATTTCTTTTTTTCTGTATGATGG + Intergenic
1194015435 X:88613477-88613499 ATGTCTTTCATCCAGAATGAGGG - Intergenic
1194556441 X:95366858-95366880 ATGTCTTTTTTTCAAGATGGTGG + Intergenic
1195669559 X:107458161-107458183 ATGCCTTAACTCCAGTATGAAGG - Intergenic
1197381012 X:125738721-125738743 ATAACATTATTTCAGTATCATGG - Intergenic
1197866509 X:131024674-131024696 ATGTATTTATTTCCTGATGAGGG - Intergenic
1199127093 X:144135852-144135874 CTGTATTTATTTCAGTGTAAAGG + Intergenic
1201059522 Y:10033332-10033354 ATGTTTGTATTTCAATATGAGGG - Intergenic
1201298853 Y:12488992-12489014 ATGTGTTTGTTTATGTATGAGGG - Intergenic
1201667309 Y:16473112-16473134 ATTTCTCAACTTCAGTATGATGG - Intergenic