ID: 1156952302

View in Genome Browser
Species Human (GRCh38)
Location 18:42917089-42917111
Sequence CCCTTTAAGCACTTGATGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156952294_1156952302 28 Left 1156952294 18:42917038-42917060 CCCAGAAAGGGTGTGACATCAGG 0: 1
1: 1
2: 3
3: 26
4: 201
Right 1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 86
1156952296_1156952302 27 Left 1156952296 18:42917039-42917061 CCAGAAAGGGTGTGACATCAGGC 0: 1
1: 1
2: 1
3: 15
4: 129
Right 1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 86
1156952293_1156952302 29 Left 1156952293 18:42917037-42917059 CCCCAGAAAGGGTGTGACATCAG 0: 1
1: 0
2: 3
3: 26
4: 187
Right 1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156952302 Original CRISPR CCCTTTAAGCACTTGATGGC CGG Intronic
901198464 1:7453490-7453512 CCCTTTTAGCATTTTATGTCCGG + Intronic
902036808 1:13463965-13463987 CCCTTGAAGCACTGGAGGGCTGG + Intergenic
902415352 1:16235633-16235655 CCCTCTAATCCCATGATGGCTGG - Intronic
907336670 1:53704297-53704319 CCCTTAAACCAATTTATGGCAGG + Intronic
907416546 1:54318381-54318403 CCCTTTGAGCCCCAGATGGCTGG - Intronic
911153893 1:94621030-94621052 CACTTTGAGCACTTGAGGGCAGG - Intergenic
912450147 1:109763538-109763560 CCCTTTAAGCCCTAGATGTAGGG + Intronic
914203160 1:145504537-145504559 CCCTTTAAGCACTTATTCACTGG + Intergenic
914237090 1:145822460-145822482 CCCTTTAAGCACTTATTCACTGG + Intronic
914482282 1:148077691-148077713 CCCTTTAAGCACTTATTCACTGG + Intergenic
922207432 1:223460866-223460888 CCCTGTAAGCATTTGATTGTTGG - Intergenic
1064141739 10:12796523-12796545 CCCTTTGAGCAATTGACAGCTGG + Intronic
1072492620 10:95922620-95922642 ACCTTTAAGCACTCAAAGGCAGG + Intronic
1073559590 10:104485536-104485558 CCCATTAACCACTTTATGCCAGG - Intergenic
1073619884 10:105035760-105035782 TACTATAAGCACTTGATGGCCGG - Intronic
1082771908 11:57214349-57214371 CTCTTTAAGCACCTGGTGACAGG + Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086791958 11:91051229-91051251 CCCTTTTAGCATTTGATGTAAGG - Intergenic
1087489721 11:98809596-98809618 CCCTAAAATCACTTGCTGGCAGG - Intergenic
1089482737 11:118820420-118820442 GCCTTCAAGAACTGGATGGCTGG - Intergenic
1092246207 12:6865835-6865857 CCCTTAAGGCACATGGTGGCTGG + Intronic
1092536442 12:9392516-9392538 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1102009500 12:109609508-109609530 CCCTGTAAGCCCTGGAGGGCAGG - Intergenic
1102685139 12:114718679-114718701 CCCTTTAAACACTTAATGCTAGG - Intergenic
1104355684 12:128083260-128083282 CCCATAAAGCATTTGATTGCAGG + Intergenic
1111497380 13:89070026-89070048 CTCAATAGGCACTTGATGGCAGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1129076822 15:73004158-73004180 CACATTAAGCATTTGAGGGCAGG + Intergenic
1129170033 15:73801939-73801961 CGCTTCAAGCACTTGAGGCCAGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131319591 15:91374499-91374521 ACATTTAAGCACTTGGTGTCTGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133466090 16:6028374-6028396 CTCTTTAAGAACATGATGACCGG + Intronic
1154202008 18:12306696-12306718 CTTTTAAACCACTTGATGGCTGG + Intergenic
1155345354 18:24852160-24852182 CCCTGTAAGCACTTGATAAAAGG - Intergenic
1155376266 18:25161182-25161204 CCCTCAAAGCACCTGATGGAAGG + Intronic
1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG + Intronic
1157625719 18:49049407-49049429 GCCTTTTAGCTCTTGAAGGCTGG - Intronic
1165418870 19:35712743-35712765 CCCTTTCAGAGCTTGATGGGAGG + Intronic
1167597697 19:50436065-50436087 CCCTTGAACCACTTGATGGTCGG - Exonic
932912834 2:75822338-75822360 CCAAGGAAGCACTTGATGGCAGG + Intergenic
936977732 2:118236295-118236317 GTCTTTAAGGAATTGATGGCAGG - Intergenic
945506378 2:210646409-210646431 GCCTTTAAGCACTCAATTGCAGG + Intronic
946772958 2:223108297-223108319 CCCTTTAAGGATTGGATGGGGGG + Intronic
1173773540 20:45684349-45684371 CCCATTAAGCACGAGATGGGTGG - Intergenic
1176277144 20:64278899-64278921 CCCTTTAAGGAGGTGAGGGCAGG - Intronic
1176346111 21:5749296-5749318 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176352925 21:5869880-5869902 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176498716 21:7575159-7575181 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1176540432 21:8147366-8147388 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176559383 21:8330411-8330433 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1177253774 21:18632470-18632492 TGCTTTAAGCAATTGTTGGCAGG - Intergenic
1181736194 22:24883578-24883600 AGCTTTATGCACTTGCTGGCTGG - Intronic
1182179350 22:28329433-28329455 CTCTATAACCACTTGATGCCAGG + Intronic
1182796775 22:32996813-32996835 CCCTTTAAGCTCTGGCTGCCCGG + Intronic
1203245375 22_KI270733v1_random:63793-63815 CCTTTTAAGCATTTCATGGGTGG + Intergenic
955941563 3:64150990-64151012 CCCTTTAAGTACTTCTTGGAGGG + Intronic
971386897 4:26149067-26149089 TTCTTGAAGCACTTCATGGCAGG - Intergenic
971664178 4:29460342-29460364 CCCTTTAAACATTTGAGGGAGGG + Intergenic
975216767 4:71764479-71764501 CCCTTTATTCACTTAATGTCTGG + Intronic
980392361 4:132163157-132163179 CCTTTTAAGCTCTTTAAGGCGGG - Intergenic
981588548 4:146330923-146330945 CCCTTGAAGCAATTTAGGGCAGG + Intronic
989258659 5:39394637-39394659 TTCTTTAAGCACTTGATATCTGG + Intronic
992594988 5:78337206-78337228 CTCTTCAAGGACTTGATGCCCGG - Intergenic
994379659 5:99056483-99056505 ACTTTTAAACACTTGTTGGCTGG - Intergenic
995566562 5:113437005-113437027 CCCTTTGGGCACTTGTTGTCAGG + Intronic
996534093 5:124558160-124558182 ACCAATCAGCACTTGATGGCTGG - Intergenic
1002198849 5:177515702-177515724 TCCTTGAAGCTCTTGATGGGTGG + Exonic
1003107227 6:3226373-3226395 CCCTTTGAGAACCTGATGGTGGG - Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018450551 6:163903350-163903372 CCTTTACAGCACTTGATGTCTGG - Intergenic
1020440684 7:8213582-8213604 CTCTTTTAGCAATTGAGGGCAGG - Intronic
1023369257 7:39496694-39496716 CCCTTGAAGAACTTGTGGGCGGG - Intergenic
1023962149 7:44935795-44935817 CCCCTTAGGGAGTTGATGGCAGG - Intergenic
1024636700 7:51296938-51296960 ACATTTAAGGAATTGATGGCTGG + Intronic
1028035972 7:85982695-85982717 CCCTTTAAGCAAATGTTGTCAGG - Intergenic
1029683011 7:102125336-102125358 CTGTTGAAGCACTTGAAGGCTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1054827944 9:69591557-69591579 GCCTGTAACCACCTGATGGCAGG + Intronic
1056149141 9:83766842-83766864 CCTTTTAAACACCTGGTGGCTGG + Intronic
1059024630 9:110612677-110612699 CCCTTTTAGCACTTGAAGGTTGG - Intergenic
1059777731 9:117492671-117492693 CCCTATGAGCAACTGATGGCAGG + Intergenic
1060673328 9:125489981-125490003 GCCTTTAACCACTTGAGGGAAGG - Intronic
1203461712 Un_GL000220v1:46865-46887 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1189057834 X:37717185-37717207 CTCTTTTATCACTTGATGGCAGG - Intronic
1189728818 X:43997307-43997329 CCCCTTATTCCCTTGATGGCAGG - Intergenic
1192204068 X:69084516-69084538 CCCTCTGAGCACTTGCTGGGGGG + Intergenic
1199988838 X:152972456-152972478 CCCTTGAAGTACTTCATGGGGGG - Exonic
1200363970 X:155641579-155641601 CCCTTTAAACCCTTTAAGGCGGG + Intronic
1200392536 X:155958321-155958343 CCCTTTAAACCCTTTAAGGCGGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic