ID: 1156953358

View in Genome Browser
Species Human (GRCh38)
Location 18:42932124-42932146
Sequence TTTCTATCATGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156953358_1156953363 -4 Left 1156953358 18:42932124-42932146 CCAGCACTCCCTCATGATAGAAA 0: 1
1: 0
2: 6
3: 40
4: 268
Right 1156953363 18:42932143-42932165 GAAATGAGGAAAGTGGTCATTGG 0: 1
1: 1
2: 2
3: 26
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156953358 Original CRISPR TTTCTATCATGAGGGAGTGC TGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902660596 1:17899307-17899329 TTTTTATCATGAAGGAATGTTGG - Intergenic
903115235 1:21173874-21173896 TTTCTACCCTGAGGGAGTATGGG - Intronic
906409049 1:45564495-45564517 TCTCTCTCATTAGGGAGTTCTGG + Intronic
909371005 1:74883420-74883442 TTTTTATCATGAAGGGATGCTGG - Intergenic
909703852 1:78557221-78557243 TTTTTATCATGAAGGAGTGTTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913028165 1:114867954-114867976 TTTTTATCATGAGTGGGTGTTGG + Intronic
915731138 1:158055337-158055359 TTTCTACCAGAAGGGAGTGGAGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915915732 1:159939588-159939610 TTTCTAGCATTAGGAAGAGCTGG - Intronic
916794945 1:168157732-168157754 TTTTTATCATGAAGGAATGTTGG + Intergenic
918205232 1:182302511-182302533 GTTCAATCAGCAGGGAGTGCAGG + Intergenic
920042260 1:203108457-203108479 TTTTTATCATGAAGGGATGCTGG - Intronic
923516459 1:234701926-234701948 TATTTATCATGAGGCTGTGCGGG - Intergenic
923848516 1:237765327-237765349 TTTTGATCATGAGGTAGTCCTGG + Intronic
924646525 1:245882501-245882523 TTTCAATCATGTGGGGGTGAGGG + Intronic
924823489 1:247516944-247516966 TTGCTTTCACGAAGGAGTGCAGG + Intronic
1064235402 10:13569297-13569319 TTTTTATCATGAATGAGTGTTGG + Intergenic
1064470915 10:15634864-15634886 TGTTTATCATGAGGGGGAGCTGG + Intronic
1064618787 10:17192847-17192869 TTTTTATCATGAGGAAATGTTGG - Intronic
1065999676 10:31092531-31092553 TTTCTCTCTTGAGGTAGTGCAGG + Intergenic
1066186988 10:33019595-33019617 TTTCTCATATGAGAGAGTGCTGG - Intergenic
1067708716 10:48630974-48630996 TTTTTATCATGAATGAGTGTTGG + Intronic
1068642081 10:59420933-59420955 TTTTTATCATGAAAGAGTGTTGG - Intergenic
1069068233 10:63968218-63968240 TTTCTATCATGAAGAAATGCTGG - Intergenic
1069122445 10:64583956-64583978 TTTTTAACATGAAGGAATGCTGG + Intergenic
1071331471 10:84565161-84565183 TTTCTAGCAAGAAGGAGTGGTGG + Intergenic
1072386333 10:94933186-94933208 TTTTTATCATGAATGTGTGCTGG - Intergenic
1073323227 10:102628137-102628159 TTTCTACCAAGAGGGAGGCCAGG + Intronic
1074105976 10:110389975-110389997 TTTCCATCATGAGGGAGAGGAGG - Intergenic
1074481959 10:113831508-113831530 TTTTTATCATGAATGGGTGCTGG - Intergenic
1080933020 11:36833136-36833158 TTTTTATCATGATGGAATGTTGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081539469 11:44020516-44020538 TTTTTATCATGAAAGAGTGTTGG + Intergenic
1083398910 11:62410763-62410785 TTTCGTTCATCAGGGAGTACAGG - Intronic
1084345594 11:68545961-68545983 TTTCTATCATGAAGGATGGCAGG - Intronic
1085435553 11:76497089-76497111 TTTTTATCATGAATGAGTGTTGG + Intronic
1085584090 11:77684620-77684642 TTTCAATCATGAGGGATTATGGG + Intronic
1085743227 11:79094515-79094537 TTTCTTTCACAAGGGAGTGAGGG - Intronic
1085757641 11:79215002-79215024 TTTCTATCTTGAAAGATTGCTGG + Intronic
1086135575 11:83440991-83441013 TTTCTATCAAGAGGGATTCTTGG - Intergenic
1087981396 11:104618377-104618399 TTTCTCTTATGAGGGGCTGCAGG + Intergenic
1090483783 11:127093203-127093225 TTTTTATCATGAAGGGATGCTGG - Intergenic
1090552194 11:127833485-127833507 TTTCTATCATAAGTAAGTGTTGG - Intergenic
1091040339 11:132273101-132273123 TTTTTATCATGAAGGAGTGTTGG + Intronic
1091458101 12:623204-623226 TCACTGTCAGGAGGGAGTGCTGG - Intronic
1092605110 12:10110229-10110251 TTTTTATCATAAAGGAATGCAGG - Intronic
1092643212 12:10539276-10539298 TTTTTATCATGAAGGGATGCTGG - Intergenic
1094691270 12:32771834-32771856 TTTCTATTAGGGGGGCGTGCTGG + Intergenic
1094790223 12:33904268-33904290 TTTCTTTCAAGAAGCAGTGCAGG + Intergenic
1095407260 12:41880658-41880680 TTTCTATCCAAAGGGAGTGCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095873381 12:47054780-47054802 TTTCTATCACAAGGCAGTGCTGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097440941 12:59607640-59607662 TTCATAACATGAGGGAATGCTGG + Intronic
1097619881 12:61926640-61926662 TTTTTAGCATGAAGGAGTGTTGG - Intronic
1099457566 12:82882512-82882534 TTTCTTTCATGTGGGGGTGAGGG + Intronic
1099706445 12:86159230-86159252 TTTTTATCATGATGGGATGCTGG + Intronic
1101548505 12:105739560-105739582 TTTCTATCATGAAGGAAGGAAGG + Intergenic
1101614607 12:106324291-106324313 GTTCTAGCCTGAGGGACTGCAGG + Intronic
1101915400 12:108892048-108892070 TTTCTATCTTGAGGAAATGATGG + Intronic
1104355019 12:128077609-128077631 TTTCCATTTTGATGGAGTGCTGG - Intergenic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1105460647 13:20582536-20582558 TTTCTATCCTGAGGTAGGGTGGG + Intronic
1105924515 13:24995672-24995694 TTTCTACCATGAGAGATAGCAGG + Intergenic
1107313635 13:39106883-39106905 TTTCTTTCCTGAGGAAGAGCAGG + Intergenic
1107701599 13:43054102-43054124 TTTTAATCATGATGGAATGCTGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108699761 13:52933668-52933690 TGTTTATCATGAGCGAGGGCAGG + Intergenic
1108928798 13:55788622-55788644 TTTTTATCATAAAGGGGTGCTGG + Intergenic
1109047423 13:57431085-57431107 TTTCTATCATGAAGGAACGCTGG - Intergenic
1109422546 13:62132184-62132206 TTTCCTTAATGATGGAGTGCAGG + Intergenic
1109782525 13:67130664-67130686 TTCCTATGATGAGGCAGTTCTGG - Intronic
1109782530 13:67130705-67130727 TTCCTATGATGAGGCAGTTCTGG - Intronic
1109932190 13:69230795-69230817 TTTTTATCATGAAGGAGCGGAGG + Intergenic
1110501470 13:76232755-76232777 TTACTATTATCAGTGAGTGCAGG - Intergenic
1111152523 13:84275147-84275169 TTTTTATCATGAAAGAGTGTTGG + Intergenic
1111568259 13:90045105-90045127 TTTCTATCATGAAGGGATGTTGG + Intergenic
1112137576 13:96598870-96598892 TTTCTATCATAAAGGAATGCTGG + Intronic
1112959615 13:105107434-105107456 TTTCTATCATGAATGGGTGGTGG - Intergenic
1114234607 14:20813216-20813238 TTTCTTTCACGTGGGAGTCCTGG - Intergenic
1116494296 14:45542281-45542303 TTTTTATCATGAAGGATTGTTGG + Intergenic
1117630397 14:57684679-57684701 TTTCTGTCAGGAGGGAGGCCAGG - Intronic
1118133658 14:62997406-62997428 TTTTTATCATGAACAAGTGCTGG + Intronic
1118646194 14:67842868-67842890 TTTTTATCATGAAGGGGTGTTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120606666 14:86586994-86587016 TTTTTATCATGAAAGAGTGTTGG - Intergenic
1121074167 14:91053152-91053174 TTTAAATCATGAAAGAGTGCTGG - Intronic
1123213785 14:106786792-106786814 TTTTTATTATGAGTGAGTGTTGG + Intergenic
1123413467 15:20078339-20078361 TTTCTATCATGAAAGGGTGTTGG + Intergenic
1123522809 15:21085451-21085473 TTTCTATCATGAAAGGGTGTTGG + Intergenic
1123956394 15:25340219-25340241 TTTTTCTCATTAGGGAGTTCTGG - Exonic
1123988372 15:25665077-25665099 TTTCTATGATGAATGAGTGATGG - Intergenic
1124245559 15:28068885-28068907 TTTTTATCATGAGGGGCTGTTGG - Intronic
1124441514 15:29689250-29689272 TTTCTAGAAGGTGGGAGTGCGGG + Intergenic
1125186683 15:36939012-36939034 TTTCTCTCATCAGGCAGAGCTGG + Intronic
1125680322 15:41526547-41526569 TTGCTATAAAGAGGGAGGGCTGG - Intronic
1128513113 15:68325835-68325857 TTTATATAATCAGGGATTGCAGG - Intronic
1131171434 15:90181607-90181629 TTTCTATCAGGAGAGGGAGCGGG + Intronic
1131656198 15:94461546-94461568 GTTCTATCATTATGGAGTGAGGG + Intronic
1133332829 16:4987212-4987234 TTTTTATCATGAAGGGGTGTTGG + Intronic
1137337796 16:47567736-47567758 TTTTTATCATGAAGGGATGCTGG + Intronic
1137749749 16:50851294-50851316 TTTTTATCATGAAAGAGTGTTGG + Intergenic
1138006338 16:53341383-53341405 TTTCTAGCCTGAGGGACTCCTGG + Intergenic
1141955896 16:87371098-87371120 ATTCTATCCTGAGGGGATGCTGG - Intronic
1142191110 16:88718321-88718343 TTTCCATCATGAGGAGCTGCTGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146614208 17:34339486-34339508 TTTTTAACATGAAGGAGTGTTGG + Intergenic
1149022470 17:51985309-51985331 TTTTAATCATAATGGAGTGCTGG - Intronic
1153108519 18:1556903-1556925 TTTTTATCATGAAGGAGTGTTGG + Intergenic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1154098834 18:11448928-11448950 TTTTTATCATGAAGGAATGTTGG - Intergenic
1154191974 18:12237423-12237445 TCTCTATCAGGAGGCGGTGCAGG - Intergenic
1154402993 18:14060060-14060082 TTTATATCATGAAGTAGTGTTGG + Intronic
1155589986 18:27416380-27416402 CTTTTATCATGAATGAGTGCTGG - Intergenic
1156212059 18:34955264-34955286 TTTTTATCATGAAGGAATGTTGG + Intergenic
1156953358 18:42932124-42932146 TTTCTATCATGAGGGAGTGCTGG - Intronic
1156991561 18:43414813-43414835 AATCTATCATGAGGAAGAGCAGG - Intergenic
1157417448 18:47516765-47516787 TTTCTATCATGAAAGGGTGTTGG - Intergenic
1160201344 18:76798304-76798326 TTTCTATCATGCATGAATGCTGG - Intronic
1160472426 18:79148536-79148558 TTTTTATCATGAATGAGTGTTGG - Intronic
1161318596 19:3630832-3630854 CTTCTATCATGGGGGACAGCGGG + Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164024035 19:21333964-21333986 TTTCTACCATGTGGCTGTGCTGG - Intergenic
1164240431 19:23383648-23383670 TGTCTCTCATGCTGGAGTGCAGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165637828 19:37358072-37358094 TTTTTATCATGAAGGGGTGTTGG + Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1168130383 19:54314126-54314148 TTTTTATCATGAAGGGATGCAGG - Intergenic
928188579 2:29139204-29139226 TTTTTATCATGAAGGGGTGTTGG + Intronic
929647503 2:43642656-43642678 TTTTTATCATGAAGGGGTGTTGG + Intronic
929915644 2:46133246-46133268 TTTCTGTGATGACAGAGTGCTGG + Intronic
931537580 2:63296238-63296260 TTTTTATCATGAAGGGATGCTGG - Intronic
932661962 2:73662875-73662897 TTTTTATCATGAAGGGGTGTTGG + Intergenic
933524675 2:83420663-83420685 TTTCTATCCTGAAGGAATGTTGG - Intergenic
934890397 2:98063282-98063304 TTTTTATCATGAGGGAATGCTGG + Intergenic
938394602 2:130934113-130934135 TTTTTATCATGAAAGGGTGCTGG + Intronic
940101090 2:150039339-150039361 TTTTTATCATGAAGGACTACTGG - Intergenic
940620152 2:156102332-156102354 TTTTTATCATGAGTGAGTGTTGG - Intergenic
942840557 2:180355490-180355512 TTTTTATCATAAGGGGATGCTGG + Intergenic
943489850 2:188537381-188537403 ATTTTATCATGAAGGAATGCTGG + Intronic
943825920 2:192391985-192392007 TTTCTATAATGATGTAGTACTGG - Intergenic
943979354 2:194527663-194527685 TTTCTATCATGTGGCTGGGCAGG + Intergenic
945035257 2:205698918-205698940 TTTCCTCCATGAGGAAGTGCTGG - Intronic
945309233 2:208291197-208291219 TTTTTATAATGAAGGAGTGTTGG + Intronic
946266969 2:218553278-218553300 TTTTTATCATGAAAGAGTGTTGG + Intronic
947849962 2:233278595-233278617 TTTCTGTGGTGAGGGAGTGGTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948746610 2:240100142-240100164 TTTTTATCATAAAGGGGTGCTGG - Intergenic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168941543 20:1716598-1716620 TTTTTATCATAAAGGAATGCTGG - Intergenic
1174134038 20:48366600-48366622 TTTCTTTCATGACGGAAGGCAGG + Intergenic
1175714776 20:61248052-61248074 TCTGTATAATGGGGGAGTGCAGG + Intergenic
1176913200 21:14593503-14593525 TTAATATCATAAGGGAGAGCTGG + Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1183426629 22:37743147-37743169 GTTCTCTCATGTGGGAGTGAGGG + Intronic
1184058276 22:42066824-42066846 TTTCAGTCCTGAGGAAGTGCAGG + Intronic
949566119 3:5246332-5246354 TCTCTCTCGTGAGGGAGTCCAGG + Intergenic
951758806 3:26122146-26122168 CTTCTATCATGAGGGATTGCTGG - Intergenic
954591235 3:51784501-51784523 TTTTTATCATGAGAGAGTGTTGG + Intergenic
955075387 3:55608545-55608567 TATCTTGCATGAGGTAGTGCCGG - Intronic
957938731 3:86977435-86977457 TTCCTATCATGAGGAAAAGCTGG - Intronic
961041673 3:123682659-123682681 TTTCTAGCATGAGGGAGACAAGG - Intronic
962656936 3:137556644-137556666 TTTTTATCATGAAGGAGTGTTGG - Intergenic
963706417 3:148693786-148693808 TTTCAACCACGAGGCAGTGCTGG + Intergenic
964635663 3:158855851-158855873 TTTTTATCATAAAGGAATGCTGG + Intergenic
964956063 3:162357237-162357259 TTTGTATCATGAAGGGATGCTGG + Intergenic
965819792 3:172673616-172673638 TTTCTTTCATGAGAGACAGCAGG + Intronic
967287367 3:187886313-187886335 TTTTTATCATGGATGAGTGCTGG + Intergenic
967400089 3:189050877-189050899 TTTCAATCATAAAGGAATGCTGG - Intronic
971726657 4:30322845-30322867 TTTTTATCATGAAGGGGTGCTGG + Intergenic
972131933 4:35847826-35847848 TTTCTATCATGAGGGGATGTTGG + Intergenic
972427758 4:38950413-38950435 TTTATAACATGAGGGAGACCAGG - Intergenic
972452022 4:39210776-39210798 TTTTTATCATGAAGGTGTGCTGG - Intronic
973559736 4:52122982-52123004 TTCATCTCATGGGGGAGTGCTGG - Intergenic
974032349 4:56787343-56787365 TTTCCATCAGGAGAGACTGCTGG + Intergenic
974543634 4:63271845-63271867 TTTTTATCATGAGGGAATATGGG + Intergenic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975746140 4:77476738-77476760 TTTTTATCATGAAGGGGTGTTGG - Intergenic
975884418 4:78947348-78947370 TTTCTACCATGAAGGGATGCTGG + Intergenic
976310517 4:83607425-83607447 TTTCTATCATGAAGCAGTTTAGG - Intergenic
976860937 4:89665464-89665486 TTGCCATCATGGGGTAGTGCTGG - Intergenic
976926080 4:90497891-90497913 TTCTTCTCATGAGGGAGTGCAGG + Intronic
978058417 4:104304094-104304116 TTTTAATCATGAGGGAGTGTGGG - Intergenic
978114084 4:104998434-104998456 TTTTTATCATGAAGGAATGTTGG + Intergenic
978658343 4:111093732-111093754 TTTTTATCATGAGAGGGTGTTGG - Intergenic
979185629 4:117788354-117788376 TATTTATCATGAAGGAGTGTTGG + Intergenic
979398541 4:120219256-120219278 TTTTTATCATGAAGGAATGTTGG + Intergenic
979398550 4:120219386-120219408 TTTTTATCATGAAGGAATGGTGG + Intergenic
980100983 4:128541011-128541033 TTTCTATCCTGATGGAGAGGTGG + Intergenic
980644802 4:135629590-135629612 TTTTAATCATAAGGGAATGCTGG + Intergenic
981348882 4:143705213-143705235 TTTCTAGCATGAGAGAGCTCCGG - Intergenic
981668043 4:147253257-147253279 TTTCTGTCATGAGGCAGTTTTGG - Intergenic
983097075 4:163575235-163575257 TTTTTATCATGAAGGAATGCTGG + Intronic
983473868 4:168191096-168191118 TTTTTATCATGAGGGAGTGTTGG - Intergenic
986227686 5:5831706-5831728 TTTCTATCATAAAGGGATGCTGG - Intergenic
986975229 5:13386452-13386474 TTTTTATCATGAAGGGATGCTGG - Intergenic
987712018 5:21512624-21512646 TGTCTATCATCAGGGCGTGGTGG + Intergenic
988186172 5:27865850-27865872 TTTTTATCATAAAGGAATGCTGG - Intergenic
989240819 5:39201659-39201681 TTTCTTTCATGTGGGAGGTCTGG - Intronic
989736586 5:44715064-44715086 TTTTTATCAGGAAGGAATGCTGG - Intergenic
991762376 5:69931766-69931788 TGTCTATCATCAGGGCGTGGTGG + Intergenic
991784949 5:70186340-70186362 TGTCTATCATCAGGGCGTGGTGG - Intergenic
991841604 5:70806816-70806838 TGTCTATCATCAGGGCGTGGTGG + Intergenic
991877396 5:71186735-71186757 TGTCTATCATCAGGGCGTGGTGG - Intergenic
993102230 5:83554661-83554683 TTTCTATCATGAGTGAGGGTGGG + Intronic
993286086 5:85999168-85999190 TTTTTATCATGATGGAATGTTGG - Intergenic
993741279 5:91543309-91543331 TTTTTATCATGAAAGAGTGTTGG + Intergenic
995416357 5:111917652-111917674 TTTTTAGCATGAAGGAGTGCTGG - Intronic
997701069 5:135899781-135899803 TCTCTTTCATGAGGAAGGGCTGG - Intergenic
998049462 5:139019955-139019977 TTTCAGTCATGAGGAAGTCCAGG - Intronic
999114118 5:149147262-149147284 TTTTTATCATGAAGGGGTGTTGG + Intronic
999413700 5:151376191-151376213 TTTTTATCATGAGGGAATGCTGG + Intergenic
1003084059 6:3047261-3047283 TTTTTATCATGAAAGGGTGCTGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003471610 6:6440949-6440971 TTTTTATGATGAAGGAATGCTGG - Intergenic
1004036163 6:11926156-11926178 TTCCTGTCCTCAGGGAGTGCAGG - Intergenic
1004999618 6:21227940-21227962 TTTGTTTCATGAAGCAGTGCAGG - Intronic
1005372094 6:25144433-25144455 TTTTTATCATGAATGAGTGTTGG - Intergenic
1006398885 6:33804415-33804437 TTTCTTTCATGAGGGGCTTCAGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1008315457 6:50034125-50034147 TTTTTATCATGAAGGTGTGTTGG - Intergenic
1008438584 6:51505735-51505757 TTTCTATCATAAAGGAATGTTGG - Intergenic
1008948286 6:57124195-57124217 TTTTTATCATGAGTGGGTGCTGG + Intronic
1009454776 6:63843545-63843567 TTTTTAGCATGAAGGAGTGTTGG - Intronic
1009700371 6:67170032-67170054 TTTTTATCATGAAGGAAGGCTGG - Intergenic
1010637432 6:78278423-78278445 TTTTTATCATAAAGGGGTGCTGG + Intergenic
1013429264 6:110041259-110041281 TTTCCATCAGGTGGGAGTCCTGG - Intergenic
1014285363 6:119491111-119491133 TTTTAATCATAAGGGAATGCTGG - Intergenic
1014852445 6:126358404-126358426 TTTTTATCATGAAGAAGTGTTGG + Intergenic
1015331718 6:131987720-131987742 TTTCTATCATGAGGGGATGCAGG + Intergenic
1016221186 6:141671748-141671770 TTTTTATCATGAAGGGATGCTGG - Intergenic
1016591859 6:145754792-145754814 TATCTAGCATGGGGGAGTGGAGG - Intergenic
1017357984 6:153532536-153532558 TTTTTATCATGAAGGGATGCTGG + Intergenic
1017995071 6:159525199-159525221 TTTCTGCCTTGAGAGAGTGCAGG - Intergenic
1019978350 7:4602820-4602842 TTCCCATCAGGAGGGAGAGCAGG - Intergenic
1020519227 7:9165565-9165587 TTTTTATCATGAAGGGGTGTTGG + Intergenic
1020538918 7:9436499-9436521 TTCATCTCATGGGGGAGTGCCGG + Intergenic
1020546296 7:9536133-9536155 TTTCTATCATGAAGGCATGGTGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025704784 7:63853266-63853288 TTTACATCAAGAGGGAGTTCTGG + Intergenic
1027813913 7:82944239-82944261 TTTGTTTCATGTGGGAGTGAGGG + Intronic
1030440764 7:109586212-109586234 TTTTTATCATGAAGAAATGCTGG - Intergenic
1030721177 7:112872412-112872434 TTTTTATCATGAAGGAATGCTGG - Intronic
1031139198 7:117922806-117922828 TTTTAATCATGAAGGAATGCTGG - Intergenic
1031351241 7:120734065-120734087 TTTCTACCATGCGGCTGTGCTGG - Intronic
1031766922 7:125790908-125790930 TTTCAATCATGACTGAGTGCTGG - Intergenic
1032187612 7:129740675-129740697 ATACTCTCATGAGGCAGTGCTGG - Intronic
1032749362 7:134822246-134822268 TCTGTTTCATGAGGGACTGCTGG + Intronic
1032788741 7:135225030-135225052 TTTTTATCATGAGAGTGTGTTGG - Intergenic
1032871495 7:135990905-135990927 TTTCCATGTTGATGGAGTGCAGG - Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034034612 7:147805622-147805644 TTTTTATCATGAAGGAATGCTGG + Intronic
1036036433 8:5025016-5025038 TTTTTATCATGAATGAGTGTTGG - Intergenic
1038071799 8:24024808-24024830 TTTTTATCATGAAGGAGTACTGG - Intergenic
1038928038 8:32162250-32162272 TATCTATCATGATGGAATGCTGG + Intronic
1039575691 8:38622140-38622162 ATTCTATCATATGGAAGTGCTGG - Intergenic
1040793671 8:51265455-51265477 TTTGTATCATGAATGAGTGTTGG + Intergenic
1040812117 8:51465344-51465366 TTTTTATCATGAAGGAATGTTGG - Intronic
1041224498 8:55685161-55685183 TCTTGATCATGAGGGAGTGAAGG + Intergenic
1042072818 8:64955682-64955704 TTCATATCACGGGGGAGTGCTGG + Intergenic
1042320043 8:67465658-67465680 TTTTTATCATGAGGGGATGCTGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044619710 8:94176877-94176899 TTTCTATCAGCAGGGTGTTCTGG + Intronic
1047137146 8:122092407-122092429 TTTTTGTCATGAGTGAGTGTTGG + Intergenic
1048883572 8:138890180-138890202 TTTTTATCATGAAAGGGTGCTGG - Intronic
1049711815 8:144067969-144067991 TCTCTATCAGGAAGGAATGCAGG - Intergenic
1051645072 9:19259973-19259995 TATCTATCATAGGGGATTGCTGG + Intronic
1052168256 9:25359990-25360012 TTTTTATAATGAGGGAGTGTTGG + Intergenic
1053414137 9:37935906-37935928 TTTCTTTAATGAGGCAGAGCAGG - Intronic
1056102650 9:83314572-83314594 TTGCTATCTTGAGGGGGTGGGGG - Intronic
1056481458 9:87010830-87010852 TTTCTGGCATGAAAGAGTGCGGG - Intergenic
1058528630 9:105884964-105884986 TGTCCAACATGAGGGAGTGGTGG - Intergenic
1059539484 9:115116618-115116640 TTTCTGTCCGGAGGGAGGGCAGG - Intronic
1059891049 9:118804789-118804811 TTTTTATCATGAAGGAATGTTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186600525 X:11031921-11031943 TTTTTATCATGAAGGTGTGTTGG - Intergenic
1187856398 X:23640066-23640088 TTTTTATCATGAAAGAATGCTGG - Intergenic
1188334093 X:28907131-28907153 TTTTTATTATGAATGAGTGCTGG + Intronic
1188568388 X:31552551-31552573 CTTCTTTTATTAGGGAGTGCAGG + Intronic
1189955526 X:46273575-46273597 TTTTTATCATGAAAGTGTGCTGG - Intergenic
1190530731 X:51372977-51372999 TTTTTATCATGAAGGGATGCTGG - Intergenic
1191593530 X:62916183-62916205 TTTCTATTATGAGGGAAGCCTGG - Intergenic
1191760259 X:64639424-64639446 TTTTTATCATGAGGGAATGTTGG + Intergenic
1191923522 X:66283304-66283326 TTTTTATCATGAATGGGTGCTGG - Intergenic
1192540505 X:71966488-71966510 TTTTTATCATGAATGAGTGCTGG + Intergenic
1192559800 X:72119943-72119965 TTTTTATCATGAAAGAGTGTTGG + Intergenic
1193235677 X:79104098-79104120 TTTTTATCATGAAAGAGTGTTGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193382282 X:80828676-80828698 TGTTTATCATGAAGGAGTGTTGG - Intergenic
1193776243 X:85645954-85645976 TTTTTATCATGAAGGAATGTTGG - Intergenic
1193788285 X:85787502-85787524 TTTTTATCATGAAGGAATGTTGG - Intergenic
1194226210 X:91261737-91261759 TTTTTATCATGAAGGAATGTTGG + Intergenic
1194373626 X:93105939-93105961 TTTTTATCATGAAGGAATGTTGG + Intergenic
1194897672 X:99465759-99465781 TATATATAATGAGGGACTGCTGG - Intergenic
1195150146 X:102059491-102059513 TTTTTATCATGAAAGAGTGTTGG - Intergenic
1195478319 X:105313817-105313839 TTTATGGCATGAGGGAGTGCGGG + Intronic
1196213768 X:113026595-113026617 TTTTTATCATGAAGGAGTGTTGG - Intergenic
1196328672 X:114440451-114440473 ATTTTATCATGAGGGGGTGTTGG + Intergenic
1196385456 X:115143924-115143946 TTTTTATCATGAAGGAATGTTGG - Intronic
1196738183 X:118999325-118999347 ATTCTATCATGAGGGGGTGAGGG - Intronic
1198976038 X:142337180-142337202 TTTTTATCATGACGGGGTGTTGG - Intergenic
1199106987 X:143880634-143880656 TTTTTATCATGAAGGAATGTTGG - Intergenic
1199367596 X:147005263-147005285 TTTTTATCATGAAGGGCTGCTGG + Intergenic
1199936737 X:152582020-152582042 TTCATCTCATGGGGGAGTGCCGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200681651 Y:6219974-6219996 TTTTTATCATGAAGGAATGTTGG + Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201567182 Y:15378067-15378089 TTTTCATCATGAAAGAGTGCTGG - Intergenic