ID: 1156954723

View in Genome Browser
Species Human (GRCh38)
Location 18:42948602-42948624
Sequence TAGGACTCCTTGGGCAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156954723_1156954728 0 Left 1156954723 18:42948602-42948624 CCCAGTTTGCCCAAGGAGTCCTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1156954728 18:42948625-42948647 GATGATATCTGACTTGTCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156954723 Original CRISPR TAGGACTCCTTGGGCAAACT GGG (reversed) Intronic
903362067 1:22783100-22783122 CAGGACTCCTAGGGCACACTTGG + Intronic
906008371 1:42499899-42499921 CAGGACACCTTGGGCCAGCTTGG + Intronic
907635181 1:56127036-56127058 TAGGAATCCTTGGGCTATTTGGG - Intergenic
911653884 1:100421032-100421054 TAGGACTTCTTGGCAAAAGTAGG + Intronic
912432368 1:109635477-109635499 TAGGATGCCCTGGGCAACCTGGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917408378 1:174733528-174733550 CAGTACTTCTTGGGTAAACTTGG - Intronic
918814902 1:189169852-189169874 TAGGTCTCCTTGGGGAAAAATGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922201204 1:223402994-223403016 TAGGCCTCTTTGGGCATACCAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1064630151 10:17302029-17302051 TAGGACTGTCTGGGCAAACTAGG + Intergenic
1067757748 10:49017754-49017776 TAAGGCTCTTTGGGCAAATTAGG + Exonic
1072319324 10:94233398-94233420 GAGGACTGCCTGGGGAAACTTGG - Intronic
1072661513 10:97366447-97366469 CAGGACTCGTTGGGCCACCTTGG + Exonic
1073001322 10:100288144-100288166 TAAAACTCCTTAGGAAAACTTGG - Exonic
1075616946 10:123897074-123897096 TAGGACCCCTGGGCCAAAGTGGG - Intronic
1080640416 11:34155260-34155282 TTGGAGTCCTTGTGCAAACAGGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081738741 11:45423490-45423512 TCAGACTCCTTGGGCACATTGGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085322243 11:75582469-75582491 TAGGAATGCCTGGGCAAACTGGG + Intergenic
1085798106 11:79562374-79562396 TGGGACAACTTGGGTAAACTGGG + Intergenic
1089528272 11:119110790-119110812 TAGGAGTCCTTGGGTAAATGGGG + Intronic
1090338863 11:125997327-125997349 TTGGATTCCTCGGGCAAACGGGG - Exonic
1093337593 12:17925889-17925911 TAGGATTTCTTGGGCTATCTGGG - Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094053136 12:26242442-26242464 CTGTACTCCATGGGCAAACTGGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096837847 12:54362478-54362500 TAATACTCCTTGGGCAGTCTAGG + Exonic
1097164969 12:57079085-57079107 GAGGCCTCCTTGACCAAACTCGG + Intronic
1098504693 12:71236142-71236164 AAGGACACCTTGGGCTAACTTGG - Intronic
1099050796 12:77779675-77779697 CAGGACACCTTGGGCCAGCTTGG + Intergenic
1099505208 12:83467072-83467094 TATGTCTTCTTGGGCAAACTTGG - Intergenic
1099824498 12:87757139-87757161 TAGGACTGCTTGGGCAGCCATGG - Intergenic
1100253800 12:92860598-92860620 TAGGACACCTTGGCCTACCTAGG - Intronic
1100291507 12:93219095-93219117 CTGGACTCCTTGTGCACACTTGG + Intergenic
1109994873 13:70109516-70109538 TTGGAGTCCTTAGGCAAAGTTGG + Intergenic
1112603039 13:100875769-100875791 TTGAACTTCTTGGGCAAACCAGG - Intergenic
1118728413 14:68649118-68649140 TTGGATTCCTTGGGCACATTAGG + Intronic
1120523160 14:85548024-85548046 AGGAACTGCTTGGGCAAACTTGG - Intronic
1121033399 14:90678932-90678954 TAGTTCCCTTTGGGCAAACTTGG - Intronic
1121348626 14:93155030-93155052 TAGGAAGCCTGGGGCAAACCTGG - Intergenic
1122794367 14:104198624-104198646 CTGGACTCCCTGGGCAACCTTGG - Intergenic
1127828877 15:62732076-62732098 TAGGACTCCTTTAGCATTCTAGG + Intronic
1128083019 15:64867435-64867457 TCAGCCTCCTTGTGCAAACTGGG + Exonic
1129064622 15:72890390-72890412 CAGGAGTCCTTGGCCAAGCTGGG + Intergenic
1129342609 15:74896071-74896093 TAGGACTCCCTGGCCAATGTGGG + Intronic
1130977802 15:88790578-88790600 TGGGACTCCATGGACAAGCTGGG - Intergenic
1132116916 15:99144097-99144119 TAGGACTCATTCGGAAAGCTGGG + Intronic
1132861602 16:2074470-2074492 CAGGACTCCTTGGGGAACCTGGG + Intronic
1133206193 16:4235218-4235240 CAGGACTCCCAGAGCAAACTCGG + Intronic
1148779655 17:50114150-50114172 CAGGACTCCGTGGGCACCCTGGG + Intronic
1150921216 17:69485567-69485589 TAGGACCCCATGGGAAATCTTGG + Intronic
1156954723 18:42948602-42948624 TAGGACTCCTTGGGCAAACTGGG - Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1163603893 19:18263997-18264019 TGGGACAGCTTGAGCAAACTGGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167360210 19:49026024-49026046 TAGGACTCCATTGACACACTGGG + Intronic
1167360871 19:49029756-49029778 TAGGACTCCATTGACACACTGGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925314034 2:2907766-2907788 TGAGACTCCCTGAGCAAACTGGG + Intergenic
925407802 2:3617260-3617282 CAGGACACCTTGGGCCAGCTTGG + Intronic
927374799 2:22401337-22401359 TAGGACTCCTTGTGAAGACAGGG - Intergenic
928982102 2:37146651-37146673 TAGGACACCATGGGCAAAGCTGG - Intronic
931262993 2:60636696-60636718 TCGGGTTCCTTGGGCAAACTTGG + Intergenic
933742408 2:85544993-85545015 TAGGACACCTTGGCCTACCTGGG - Exonic
933806071 2:85998690-85998712 TAGGAGCCCTTGGGGAAACTGGG + Intergenic
934161548 2:89254156-89254178 TAGGACCCCTGGGGGACACTAGG - Intergenic
934205735 2:89928259-89928281 TAGGACCCCTGGGGGACACTAGG + Intergenic
934659611 2:96136276-96136298 TAGGCCACCTTGGGCAGACAAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942760997 2:179398211-179398233 AAGGACTCCTTGGGCAGTGTGGG - Intergenic
944309468 2:198217545-198217567 TAGGACACCTTGCACAAAATTGG - Intronic
947612609 2:231533125-231533147 TAGGCTTCATTGGGCAAACATGG + Intergenic
948365583 2:237452473-237452495 AAGGGCTCCTTAGGAAAACTAGG + Intergenic
948432370 2:237927880-237927902 CAAGTCTTCTTGGGCAAACTGGG + Intergenic
1174482334 20:50840327-50840349 CAGGACACCTTGGGCCAGCTTGG + Intronic
1177718556 21:24873421-24873443 TAGGATTGCTTTGGCAATCTGGG + Intergenic
1181820179 22:25469338-25469360 TAGGAATAATTAGGCAAACTGGG - Intergenic
949741940 3:7245345-7245367 TAGGACATCATGGTCAAACTAGG + Intronic
959002131 3:100976728-100976750 TGGGCCTCCTGGGACAAACTTGG - Intronic
959242542 3:103815864-103815886 TAGAACTACTGTGGCAAACTGGG + Intergenic
959997579 3:112695673-112695695 TAGGACACCTTGGCCTACCTGGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965449193 3:168816591-168816613 TAGAGCTCCTTGGGGAAACCAGG + Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
976951550 4:90838601-90838623 CAGGACACCTTGGGCCAGCTTGG + Intronic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
990864999 5:60370215-60370237 CAGCACTACTTGGGCAAACTGGG - Intronic
996206674 5:120746461-120746483 TAAGACTTCTTGAGCCAACTCGG + Intergenic
998872353 5:146565269-146565291 AAGAACTTCTTGGGGAAACTAGG + Intergenic
1000300736 5:159954062-159954084 TGGAACTCCTGGAGCAAACTGGG + Intronic
1001585577 5:172831937-172831959 TAGGTTTCCTTGGGAGAACTGGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015607634 6:134975437-134975459 TAGGACTGCTTTGGCTAATTGGG - Intronic
1016288613 6:142503118-142503140 TAGGACTGCTTTGGCTAATTTGG + Intergenic
1017512658 6:155128098-155128120 ATAGACTCCTTGAGCAAACTGGG + Intronic
1023842816 7:44106599-44106621 AAGGACTCCTTGGGCACCTTGGG - Exonic
1025171614 7:56763383-56763405 TGGGACTCCATTGACAAACTGGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031359269 7:120827779-120827801 TAGAACTGCTTAGACAAACTTGG - Intronic
1036396846 8:8377474-8377496 CAGCACTCCTTGGGGAAGCTCGG + Exonic
1040418932 8:47221214-47221236 TTGGTCTCATTGTGCAAACTGGG - Intergenic
1051061145 9:13046586-13046608 TAGGTAACCTGGGGCAAACTTGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057860654 9:98638236-98638258 TAGGAATCCTAGGACAACCTTGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059100487 9:111466832-111466854 GAGGATTGCTTGGGCAAAATAGG - Intronic
1061361215 9:130143457-130143479 CAGCATTCCTTTGGCAAACTGGG - Intergenic
1186788840 X:12977095-12977117 CAGGACACCTTGGGCCAGCTTGG - Exonic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195084141 X:101398386-101398408 CAGGACCCCTTGGGCAAGCAAGG - Exonic
1196384437 X:115133372-115133394 CAGGACACCTTGGGCCAGCTTGG - Intronic