ID: 1156955136

View in Genome Browser
Species Human (GRCh38)
Location 18:42953537-42953559
Sequence TGCCCCTAATAGGCCAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156955136_1156955140 0 Left 1156955136 18:42953537-42953559 CCGACTCTGGCCTATTAGGGGCA No data
Right 1156955140 18:42953560-42953582 GGGATGCTTACAAGAATAACAGG No data
1156955136_1156955141 14 Left 1156955136 18:42953537-42953559 CCGACTCTGGCCTATTAGGGGCA No data
Right 1156955141 18:42953574-42953596 AATAACAGGAACCCCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156955136 Original CRISPR TGCCCCTAATAGGCCAGAGT CGG (reversed) Intronic