ID: 1156959598

View in Genome Browser
Species Human (GRCh38)
Location 18:43008912-43008934
Sequence TCCTAATTGGTTAAAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156959596_1156959598 -5 Left 1156959596 18:43008894-43008916 CCTCTGTGGAGCTCAGTTTCCTA No data
Right 1156959598 18:43008912-43008934 TCCTAATTGGTTAAAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156959598 Original CRISPR TCCTAATTGGTTAAAAATAC AGG Intronic