ID: 1156959600

View in Genome Browser
Species Human (GRCh38)
Location 18:43008946-43008968
Sequence GTCTTGTTAAAGTTATGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156959596_1156959600 29 Left 1156959596 18:43008894-43008916 CCTCTGTGGAGCTCAGTTTCCTA No data
Right 1156959600 18:43008946-43008968 GTCTTGTTAAAGTTATGCTGAGG No data
1156959599_1156959600 10 Left 1156959599 18:43008913-43008935 CCTAATTGGTTAAAAATACAGGA No data
Right 1156959600 18:43008946-43008968 GTCTTGTTAAAGTTATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156959600 Original CRISPR GTCTTGTTAAAGTTATGCTG AGG Intronic