ID: 1156961298

View in Genome Browser
Species Human (GRCh38)
Location 18:43034908-43034930
Sequence CAAGGCACAGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 0, 2: 8, 3: 126, 4: 980}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156961298_1156961304 11 Left 1156961298 18:43034908-43034930 CCTTCCTCCTCCTCTGTGCCTTG 0: 1
1: 0
2: 8
3: 126
4: 980
Right 1156961304 18:43034942-43034964 CTGCATGTCCTTTCTGTGTTTGG 0: 1
1: 0
2: 2
3: 22
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156961298 Original CRISPR CAAGGCACAGAGGAGGAGGA AGG (reversed) Intronic
900099809 1:957003-957025 GAAGCCAGTGAGGAGGAGGATGG - Exonic
900150451 1:1176686-1176708 ACAGGCACAGAGCCGGAGGAAGG - Intronic
900214767 1:1475522-1475544 CAAGGGACAGAGGAGGCAGTCGG - Intronic
900221979 1:1513878-1513900 CAAGGGACAGAGGAGGCAGTCGG - Intronic
900296627 1:1955153-1955175 GAAGACAGACAGGAGGAGGACGG + Intronic
900484431 1:2914712-2914734 CCAGGCTCAGAGCAGGATGAGGG + Intergenic
900891965 1:5456069-5456091 GAAGGGGCAGAGCAGGAGGATGG - Intergenic
901040013 1:6358168-6358190 CAAGTCAAAGAGGAGAAGCAGGG - Intronic
901770228 1:11526443-11526465 CAAGGCTCAGAGAGGGAGGAAGG + Intronic
901809514 1:11759472-11759494 CAAGGCAGAGAGGTAGGGGAGGG + Intergenic
902637444 1:17743797-17743819 CAAGGCAGAGAGGAGGATTGGGG + Intergenic
902644424 1:17788594-17788616 CCAGGTGCAGAGGAGGAGGGTGG + Intronic
902783774 1:18720332-18720354 CGAGGCCCAGAGGAAGAGGCAGG + Intronic
903168503 1:21537788-21537810 CAAGGCTCAGAACAGGAGGGAGG - Intronic
903218341 1:21855195-21855217 GGAGCCACAGAGGAGGAGGTGGG + Intronic
903337297 1:22633657-22633679 GGAGGAAAAGAGGAGGAGGAGGG - Intergenic
903480174 1:23647292-23647314 GAAGGCACAGAAGAGGAAGGAGG - Intergenic
903578039 1:24351321-24351343 GAAGGAACCAAGGAGGAGGAAGG - Intronic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904285604 1:29451617-29451639 CAAGGATGAGAGGAGGGGGAGGG + Intergenic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904403017 1:30269294-30269316 CCAGGCAGAGAGGAGGGGAAAGG + Intergenic
904700832 1:32357154-32357176 CAAGGCAGAGGGGAGGAGAAGGG + Intronic
904819951 1:33235490-33235512 CAAGGCACAGATGTGGAGAGAGG - Intergenic
904928366 1:34066348-34066370 CAAGGCAGAGAGGGGGATGCAGG - Intronic
904943006 1:34177840-34177862 CCAGAAAGAGAGGAGGAGGATGG + Exonic
905130971 1:35757082-35757104 CAAGGCAGAGAGGTGAGGGAGGG - Intronic
906276885 1:44523367-44523389 CTAGGCAAAGAGGAGGTGAAAGG - Intronic
906697752 1:47836019-47836041 AATGGCACAAAGGAGGAGGGAGG + Intronic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907924654 1:58944178-58944200 GAAGGCACTGAGGAGGACCATGG + Intergenic
907968269 1:59354990-59355012 CAAGGCACAGAGGCGTAGGAGGG + Intronic
907972150 1:59393578-59393600 GAAGGGAGAGAGGAGGGGGATGG - Intronic
908000143 1:59671515-59671537 CCAGGCTCAGAGTAGGTGGAGGG + Intronic
908034878 1:60041158-60041180 CAAGGAGCAGAAGAGGAGGTAGG + Intronic
908666661 1:66499535-66499557 GAAGACACTGAGGAAGAGGATGG + Intergenic
908747975 1:67394182-67394204 AAAGACAGAGAGGTGGAGGAAGG + Intronic
909585120 1:77281295-77281317 GAAGGGACAGTGGAGGAGAAAGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910270011 1:85384427-85384449 CAGGCCACAGAGGTGGAGGAGGG - Intronic
910419600 1:87044045-87044067 CAAGACACTGGGGAGGAGAAAGG + Intronic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911463224 1:98216572-98216594 CAAGGCACAGAGTATGAATATGG - Intergenic
911683071 1:100740926-100740948 CAAGGGCCAGAGGAGGTGGTGGG - Intergenic
912073414 1:105842020-105842042 CAAGAAACACAAGAGGAGGAGGG + Intergenic
912528462 1:110302878-110302900 CAAGGGACAGAGAAGGAGTTGGG + Intergenic
912776260 1:112508212-112508234 CGAGGCACAGAGGGGGAGCGGGG + Intronic
913034446 1:114949517-114949539 CAAGTCACATAGCAGAAGGAGGG - Intronic
913398171 1:118395966-118395988 GAAGGAAGAGAGGAGGAGGCTGG - Intergenic
913446212 1:118953427-118953449 CAAGGCCCAGAGTGGGAGGTTGG - Intronic
913481529 1:119293854-119293876 CAAGGCAGAAAGGAACAGGAAGG - Intergenic
913697014 1:121336451-121336473 GAAGGCAGAGGGGAGAAGGAAGG - Intronic
914140545 1:144943593-144943615 GAAGGCAGAGGGGAGAAGGAAGG + Intronic
915262073 1:154684178-154684200 GAAGGCAGAGAGGAGAAGGCTGG + Intergenic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915976668 1:160395496-160395518 CCAGGCAGAAAGAAGGAGGAAGG + Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916475184 1:165162335-165162357 TAGGGCAAAGAGGAGTAGGAAGG + Intergenic
916881625 1:169024553-169024575 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
916881630 1:169024575-169024597 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
916881638 1:169024610-169024632 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
917119057 1:171629842-171629864 GAAGGCACAGTGGTGGAGGAAGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917521362 1:175750754-175750776 TGAGGCACAGAGGAGGAGAAAGG - Intergenic
917591863 1:176484164-176484186 CTATGCACATAGGAGGAGAACGG - Intronic
917802137 1:178580827-178580849 CAAAGACCAGAGGAGGGGGAGGG - Intergenic
918002623 1:180512191-180512213 CCATGCACAGACGAGGGGGAGGG + Intergenic
918146148 1:181757858-181757880 CCATGCTCAGAAGAGGAGGACGG - Intronic
918663120 1:187114215-187114237 ATAGGCACAGAGTAGGAGGATGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918843302 1:189573377-189573399 TTAGGGACAGAGGTGGAGGAAGG + Intergenic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920020965 1:202956467-202956489 CAAGGCAAAGAGGAGTCAGAGGG + Intronic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920232441 1:204479661-204479683 CGAGGCAAAGCTGAGGAGGATGG - Intronic
920288944 1:204902950-204902972 GCAGGCACAGAGTAGGTGGAAGG + Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920484345 1:206354788-206354810 GAAGGCAGAGGGGAGAAGGAAGG - Intronic
920497814 1:206467991-206468013 CAAGGACCAGAGGTGGAAGAGGG - Intergenic
920500033 1:206480131-206480153 CTGGGCACAGAGGGGGAGGCGGG + Intronic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920515301 1:206580773-206580795 GAAGGCACACAGGAGAAGGCTGG + Intronic
920853890 1:209648162-209648184 CAAGACAGAGAGGTGGAAGATGG + Intronic
920866641 1:209758880-209758902 AAAGGCACAGAGAAGGAAAAGGG + Intronic
920972210 1:210752645-210752667 TAGGGAACAGAGGATGAGGAGGG + Intronic
921418807 1:214922250-214922272 CAAGACAAAGAAGAGGAGGTGGG - Intergenic
921422236 1:214961646-214961668 CAAGGCACCGAGGAGCTGGTGGG - Intergenic
922362283 1:224834122-224834144 CCAGGGGCACAGGAGGAGGAAGG - Intergenic
922900110 1:229130076-229130098 AATGGCACAGAGGAGGAAGCTGG + Intergenic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
923041884 1:230325517-230325539 TAATGAGCAGAGGAGGAGGAGGG + Intronic
923051362 1:230393218-230393240 AAAGGAGGAGAGGAGGAGGAAGG + Intronic
923216185 1:231850175-231850197 CAAGGAACAGAGGAGGGTGGAGG + Intronic
923412754 1:233726023-233726045 GAGGGGACAGAAGAGGAGGAAGG + Intergenic
923482329 1:234397200-234397222 GAAGGGGAAGAGGAGGAGGAGGG + Intronic
923676827 1:236087594-236087616 AAAGGCTAAGAGGAGGAGAAGGG - Intergenic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063357226 10:5412673-5412695 CATGGCACGGAGGAGGGGGTGGG - Exonic
1063549765 10:7019752-7019774 CAAGGAGCAGAGGAAGAGAAAGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064245012 10:13661347-13661369 GCAGGCAAAGAGGAGGAGGAAGG + Intronic
1064287325 10:14003186-14003208 CACGGAATAGAGGAGCAGGACGG + Intronic
1064354794 10:14606703-14606725 AAAGGGACAGAGGGGAAGGAGGG - Intronic
1064627244 10:17273855-17273877 AAAGGAGGAGAGGAGGAGGAGGG - Intergenic
1065228062 10:23567389-23567411 CAAGGCACAGAGTAGGTCAATGG - Intergenic
1065466105 10:26024418-26024440 AAAGGCACAGAGGATAAAGATGG - Intronic
1065712679 10:28532970-28532992 CAGGCCTCAGAGGAGGAGAAAGG + Intronic
1066443866 10:35464173-35464195 TAAGGCACAGAGGAGGGAGCTGG - Intronic
1066542849 10:36467784-36467806 TAAGGCACACAAGAGGAGGCAGG + Intergenic
1066551549 10:36563852-36563874 TTAGGCAGAGAGGAGGAGGAAGG + Intergenic
1067098557 10:43318359-43318381 CCAGGCACAGAGGAAGGGGAGGG - Intergenic
1067160515 10:43821339-43821361 CCAGGGACAGATGAGGGGGATGG - Intergenic
1067247668 10:44559842-44559864 TAAGGCACAGGGGTGGAGGGAGG - Intergenic
1067830208 10:49607361-49607383 CAAGACCCATGGGAGGAGGAAGG - Intergenic
1068891285 10:62150739-62150761 GAAGGGACAGGGTAGGAGGAGGG - Intergenic
1068900174 10:62259455-62259477 CAAGGCAAAGATGAAAAGGAAGG - Intronic
1069093551 10:64230247-64230269 CAGCCCACAGAGGATGAGGATGG - Intergenic
1069132947 10:64728915-64728937 CAATGGTCAGAGGTGGAGGAAGG + Intergenic
1069561391 10:69432972-69432994 CATGGCGAAGAGGATGAGGAAGG + Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069742804 10:70696269-70696291 CCAGCCACAGAAGAGGAGAAGGG + Intronic
1069797699 10:71063739-71063761 CGAGGCTGAGAGGAGGAGGCAGG + Intergenic
1069825019 10:71249678-71249700 CAAAGCACAGAGCAGGTAGAAGG + Intronic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1069902319 10:71713286-71713308 CAAGGCTCAGAGGGAGAGAAGGG + Exonic
1070129907 10:73648675-73648697 ACAGGCGCTGAGGAGGAGGACGG - Exonic
1070415882 10:76188831-76188853 CAAACCCAAGAGGAGGAGGATGG + Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070642861 10:78181716-78181738 CTAGGCACACAAGAGGAGGCAGG + Intergenic
1070692071 10:78534245-78534267 GAGGAGACAGAGGAGGAGGAGGG - Intergenic
1070722016 10:78763463-78763485 CAAGGCACAACAGAGCAGGATGG - Intergenic
1071138023 10:82473926-82473948 TAAGGCCCAGAGGAGAAGTAGGG + Intronic
1071333934 10:84586555-84586577 CAAGGATAAGAGGAGAAGGAGGG - Intergenic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071526572 10:86363002-86363024 CAAGGCAGAGGGAAGGAGAAGGG + Intronic
1072439280 10:95439409-95439431 CAAGGGCCAGAGAAGGAGGAAGG - Intronic
1073108256 10:101045580-101045602 CAAGGCACAGTGGGGTGGGATGG + Intergenic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1075106401 10:119542699-119542721 GAAGGCGAGGAGGAGGAGGAGGG + Exonic
1075656863 10:124167821-124167843 CAAGGCCCAGGGAAGGAGGGAGG - Intergenic
1076005715 10:126947072-126947094 TGAGGCAAAGAGCAGGAGGAAGG - Intronic
1076006347 10:126950696-126950718 TGAGGCAAAGAGCAGGAGGAAGG - Intronic
1076047255 10:127304168-127304190 CAAGGCACACAGGATGGGGGTGG + Intronic
1076096615 10:127738305-127738327 CAATCCAGAAAGGAGGAGGAAGG - Intronic
1076770010 10:132657634-132657656 GAGCTCACAGAGGAGGAGGAGGG - Intronic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077407972 11:2391109-2391131 CAAGGCCAGGAGGAGGAGGAGGG + Intronic
1077444085 11:2582284-2582306 CCAGCCACTGAGGAGGAGGGAGG - Intronic
1077649052 11:3953038-3953060 GAATGCTTAGAGGAGGAGGAAGG + Intronic
1077910170 11:6566364-6566386 CATGGCACAGAGGGAGAGGGTGG - Exonic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078712486 11:13807846-13807868 CAAGACACAGAGAAAGAAGACGG - Intergenic
1080748330 11:35128999-35129021 AAAGACTCAGAGGAGGAGCAAGG + Intergenic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081645848 11:44789890-44789912 CCAGGCTCAGAGGAGCTGGAAGG + Intronic
1081656832 11:44862878-44862900 CATGGCCCTGGGGAGGAGGAAGG + Intronic
1081802566 11:45869928-45869950 CAAGCCACAGAGGATCTGGAGGG - Intronic
1083337386 11:61931655-61931677 GAAGGCAAGGAGGAGGAAGAAGG + Intergenic
1083736888 11:64686495-64686517 CAAGGAGCAGATGAGGAGAATGG + Intronic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1083951383 11:65958506-65958528 CAAGGGAAAGAGGATGGGGAGGG + Intronic
1084009190 11:66338343-66338365 CAAGCCACAGAGGTGGGGGGTGG - Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084332498 11:68438224-68438246 CGGGGGTCAGAGGAGGAGGAGGG + Intronic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1084665062 11:70571841-70571863 AAAGCGAGAGAGGAGGAGGAGGG + Intronic
1084941005 11:72613364-72613386 CAAGGCCCAGAGAGAGAGGAGGG - Intronic
1085310046 11:75510759-75510781 GGAGGCCCGGAGGAGGAGGAGGG - Intronic
1085428785 11:76428381-76428403 AAAGGCACAGAGGTGCAAGAAGG + Intergenic
1085516208 11:77113279-77113301 GAAGGCACGGAGCAGAAGGAGGG - Intronic
1085521680 11:77142837-77142859 CAAGGCATGGGGCAGGAGGAGGG - Intronic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087321137 11:96660320-96660342 CAAGTCACAGAGTAGCATGAGGG - Intergenic
1087817916 11:102679380-102679402 CAAGAGAGAGAGTAGGAGGAGGG + Intergenic
1088047790 11:105474416-105474438 CAAGGTATTGAGGATGAGGAAGG + Intergenic
1088087388 11:105997215-105997237 GAAGGGGAAGAGGAGGAGGAAGG + Intronic
1088737011 11:112736113-112736135 CAAGGCAGGCAGGAGCAGGAGGG + Intergenic
1088843184 11:113643776-113643798 AAATGCAGAGAGGAGGAAGAAGG - Intergenic
1089143488 11:116307244-116307266 CAAGTCAGAGAGGAAGAGGAAGG + Intergenic
1089396977 11:118142555-118142577 CCATACACAGAAGAGGAGGAAGG + Intronic
1089498202 11:118918407-118918429 CAAGCCAGCGAGGAGGAGCAAGG + Intronic
1089555694 11:119315050-119315072 GGAGACACAGAGGAGGAGAAGGG + Intronic
1089688633 11:120172484-120172506 CAGGCCACACAGGAGCAGGAGGG - Intronic
1089784134 11:120895889-120895911 CCATGCAGAGAGGAGGAGGAAGG + Intronic
1089814813 11:121162754-121162776 GAAGGCACAGGGCAGGTGGAAGG + Intronic
1090228570 11:125085921-125085943 CAAGGCACAGAGGGAAGGGAGGG - Intronic
1090267633 11:125363531-125363553 TAAGGCACAGAGGAGAGGCAAGG - Intronic
1090468195 11:126954516-126954538 AAAGGCCTAGAGGAGGACGAGGG - Intronic
1090525586 11:127531425-127531447 AAAGGCACAGGGGAAGAAGAAGG + Intergenic
1090601698 11:128379049-128379071 CATGGCAGAGAGGAAGAGGGAGG + Intergenic
1090679995 11:129045223-129045245 CACGGCACAGAGGAGGAGACAGG - Intronic
1091121082 11:133058192-133058214 CAAACCATAGAGGAGGAGGAAGG + Intronic
1091155349 11:133366879-133366901 GAAGGCACAGAGGAGCAGGGAGG + Intronic
1091196185 11:133732742-133732764 CAGGGCTCAGAGCAGCAGGAGGG - Intergenic
1091268478 11:134288926-134288948 AAACGCACAGAGGAGGAAGGAGG - Intronic
1091296417 11:134477008-134477030 TAGGACAGAGAGGAGGAGGAGGG + Intergenic
1091343160 11:134835617-134835639 TAAGCCCCAAAGGAGGAGGATGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091407866 12:220363-220385 CACAGCACAAAGGCGGAGGAAGG + Intergenic
1091663387 12:2400943-2400965 AAAGGCTCAGAGGATGAGGATGG - Intronic
1091699575 12:2650930-2650952 CAGGGCAGAGGGGAGTAGGAGGG + Intronic
1091795077 12:3293518-3293540 CAGGGCACATAGGAGGTGGTGGG + Intergenic
1091885631 12:4015278-4015300 CAAGGCAGAATGGAAGAGGAAGG + Intergenic
1091896473 12:4109241-4109263 AAGGGCACAGAGGAGGAGAGAGG + Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092524141 12:9299285-9299307 GAAGCCAAAGAGGAGGAGGCAGG + Intergenic
1092543127 12:9432527-9432549 GAAGCCAAAGAGGAGGAGGCAGG - Intergenic
1092749097 12:11701871-11701893 CAAGGCAGAGAAGAAAAGGATGG + Intronic
1092920513 12:13227525-13227547 AAAGGCAGAGGGGAGGAAGAGGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093567677 12:20627633-20627655 CAATGCACAGAGTAGAAGGCAGG - Intronic
1093913215 12:24770825-24770847 CAAGCCATTGAGGATGAGGATGG - Intergenic
1094106486 12:26817215-26817237 CAAAGCACAGAGCTAGAGGAAGG + Intronic
1094509892 12:31089911-31089933 GAAGCCAAAGAGGAGGAGGCAGG + Exonic
1096413593 12:51394041-51394063 CAAAGGGCAGAGGTGGAGGAAGG - Intronic
1096531689 12:52246604-52246626 GGAGGCGGAGAGGAGGAGGAAGG + Intronic
1096677235 12:53232322-53232344 CAGGGCACAGAGGAGGGAGCCGG - Intronic
1096717505 12:53500052-53500074 CCAGGAACACTGGAGGAGGATGG - Intronic
1096737242 12:53665317-53665339 CATGGCAAAGAGGATGAGAAAGG + Exonic
1097364133 12:58692310-58692332 CAAGACACAGGAGAGGAGAAAGG + Intronic
1097679362 12:62634146-62634168 CAGGTCACGGAGGAGGAGGGAGG - Intergenic
1098073199 12:66698608-66698630 CAAGAAACAGGGAAGGAGGAAGG - Intronic
1098326211 12:69305108-69305130 CACAGCACAAAGGAGGTGGATGG - Intergenic
1099206499 12:79734359-79734381 GAAGACTCAGAAGAGGAGGAGGG + Intergenic
1099345771 12:81497980-81498002 AAAGACACAGACAAGGAGGAGGG + Intronic
1100708759 12:97230970-97230992 CAAGGAGCAGAATAGGAGGATGG + Intergenic
1101209057 12:102518125-102518147 CAAGGCACAGAGGTGAGGAAAGG - Intergenic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1101843155 12:108342127-108342149 GGAGGAAGAGAGGAGGAGGAGGG + Intergenic
1102303087 12:111785071-111785093 AAAGGCAGGGAGGAGGAGGAAGG - Intronic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102657068 12:114491007-114491029 CATGGCCCAGAGGAGGAGAGTGG - Intergenic
1103408810 12:120695870-120695892 CAAGTCCCTGAGGAGGAGGCAGG + Intronic
1103430390 12:120879951-120879973 CAGGGAACAGAGGTGGAGTATGG - Intronic
1103552912 12:121749312-121749334 CTAGGGACAGAGGGGCAGGAAGG - Intronic
1103643450 12:122371675-122371697 CAGGACACAGGCGAGGAGGATGG + Intronic
1103870630 12:124088796-124088818 AAAGGCAGAGAGGAGGAGAGAGG - Intronic
1103971306 12:124674444-124674466 GGAGGGAGAGAGGAGGAGGAGGG - Intergenic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104494649 12:129225754-129225776 CAAGAGAGAGAGGAAGAGGAGGG + Intronic
1104690081 12:130819048-130819070 CAGGGCAGAGAGGTGGACGAAGG - Intronic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105350178 13:19607879-19607901 AAAGGCAGAATGGAGGAGGAAGG - Intergenic
1105579159 13:21677301-21677323 GAAGGAAGAGGGGAGGAGGAAGG - Intronic
1106160190 13:27194531-27194553 CCAAGCAGTGAGGAGGAGGAAGG + Intergenic
1106229113 13:27808114-27808136 ATAGGCACAGAGGTGGAAGATGG + Intergenic
1107128965 13:36874527-36874549 CAAGGATGAGAAGAGGAGGAAGG + Intronic
1107333094 13:39322747-39322769 AAAGGAAGAGAGAAGGAGGAAGG + Intergenic
1107347990 13:39483698-39483720 CAATGCAGAGAGGAAGAAGATGG + Intronic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1108092099 13:46859633-46859655 CATGGCCCAGAGCAGGAGGAAGG - Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108153210 13:47557748-47557770 CCAGTCACAGAGTAGAAGGAAGG + Intergenic
1108260116 13:48647679-48647701 CAAGGCTCTGGGGATGAGGAAGG - Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109471655 13:62814547-62814569 AAAGGCACAGAGTAGAATGATGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1110153374 13:72282776-72282798 CAAAGGTCAGAGGAAGAGGAAGG + Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110915368 13:81014380-81014402 AAAGGCACAGAGTGGCAGGATGG - Intergenic
1111841633 13:93456819-93456841 AAAGGCAGAGAGTAGGATGATGG - Intronic
1111961205 13:94812536-94812558 CAAGAGAAAGAGGAGGAGGGAGG - Intergenic
1112792398 13:103017069-103017091 GAAGACGAAGAGGAGGAGGATGG - Intergenic
1112869178 13:103948362-103948384 CAAGGCTTAGAGCAGGAGGTGGG - Intergenic
1113075148 13:106460856-106460878 CAAGGCAGAGAGGAAGAGACAGG + Intergenic
1113095947 13:106663822-106663844 CATGACAAAGAGGATGAGGAAGG - Intergenic
1113129822 13:107023484-107023506 CAAGGGCAAGAGGAGGATGAAGG - Intergenic
1113162234 13:107394852-107394874 CAAGGAACAGGGAAGGAGGAAGG + Intronic
1113321995 13:109243015-109243037 TAGAACACAGAGGAGGAGGAAGG + Intergenic
1113759176 13:112835648-112835670 CAAGGCCCTGAGGAGGCTGAGGG + Intronic
1113961320 13:114127856-114127878 CACGGCACTGAGGTGGAGAAAGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114552613 14:23542050-23542072 TAAGGCAGAGAAGAGGAGGGAGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1115220224 14:31051311-31051333 CCAGGCACAGCAGAGCAGGATGG + Intronic
1115425476 14:33254051-33254073 TAAAGCAGAGAGGATGAGGATGG - Intronic
1115871554 14:37809879-37809901 CAAGTAACAGAGAAAGAGGATGG - Intronic
1116366419 14:44071238-44071260 CAAGGAACAGGGGAGGGGTAGGG - Intergenic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117479041 14:56125053-56125075 GAAGGCACAGTGGAGTTGGAAGG + Intronic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118728869 14:68652585-68652607 GAAGAAACAGATGAGGAGGAAGG - Intronic
1118959567 14:70516527-70516549 CCAGGCTCAGAGTAGGAGGAGGG + Intergenic
1118985825 14:70753811-70753833 CTAGGATCAGAGGTGGAGGAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119413447 14:74453439-74453461 CAAGGAACAGGGGAACAGGAAGG + Intergenic
1119477753 14:74940998-74941020 CAAAGCACTGAGGAGGAAGACGG + Intergenic
1119781357 14:77278471-77278493 CCAGGCACAGAGCCGCAGGAGGG + Exonic
1120016053 14:79474823-79474845 AGAGGGAAAGAGGAGGAGGAAGG + Intronic
1120905934 14:89621281-89621303 TTTGGCAGAGAGGAGGAGGAAGG - Intergenic
1121484812 14:94306369-94306391 GAAGGGACAGAGCAGGAGGCAGG + Intronic
1121664670 14:95663364-95663386 CAACTCACAGAGGAGCAGAATGG + Intergenic
1121748044 14:96318206-96318228 CAAAGAACAGAAAAGGAGGACGG + Intronic
1121880460 14:97496004-97496026 CAAGGCACTGATGAAGATGAAGG - Intergenic
1122025501 14:98873000-98873022 AAAGGTACAGACCAGGAGGAGGG - Intergenic
1122359642 14:101151704-101151726 CAAGGCAGGGAGGTGGAGGGAGG - Intergenic
1122719724 14:103715453-103715475 GAAGGCCGAGAGGAGCAGGACGG - Intronic
1122881766 14:104693480-104693502 CAGGGCACAGTTGAGGAGGGAGG + Intronic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1122982116 14:105196615-105196637 CGAGGCCCAGACGAGGAGGCCGG - Intergenic
1123756699 15:23402557-23402579 CATTGCACAGAGGTGGATGAAGG - Intergenic
1125274571 15:37977597-37977619 CAAAGCACAGAGATGGAGCATGG - Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125405920 15:39352625-39352647 GAAAGCACAGAGCTGGAGGATGG + Intergenic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125883677 15:43213221-43213243 CCAAGCAGAGAGGAGGAGGCTGG - Intronic
1126373570 15:47972068-47972090 CAAGAGACAGAGGAGGAAGAAGG - Intergenic
1126454779 15:48849274-48849296 CCAGGCACAGAGAGGGAGGTAGG - Intronic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127546716 15:59999764-59999786 CAAGGGAGAGAGGCGGGGGAGGG - Intergenic
1127754917 15:62082911-62082933 GAAGACAAAGAGGATGAGGATGG - Intergenic
1128512192 15:68320128-68320150 CCTGGCACAGAGGAAAAGGAAGG - Intronic
1128606016 15:69037207-69037229 CAAGGTACAAAGGTGGGGGATGG + Exonic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128780737 15:70357169-70357191 CAGGGAACAGAGGAGGGGGTGGG + Intergenic
1129224997 15:74164199-74164221 CAAGGTAGAGAGGAGCTGGAGGG - Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1129738179 15:77977168-77977190 AAAGGCACAGAGGGGAAGGATGG - Intergenic
1129847893 15:78776425-78776447 AAAGGCACAGAGGGGAAGGATGG + Intronic
1130033896 15:80340958-80340980 CAGGAAACAGAGGAGGAGAAGGG + Intergenic
1130254019 15:82317491-82317513 AAAGGCACAGAGGGGAAGGATGG - Intergenic
1130282661 15:82531876-82531898 GAAGGGAAAGGGGAGGAGGATGG + Intergenic
1130397149 15:83512659-83512681 GAAGGAAGAGAGAAGGAGGAGGG - Intronic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1130959923 15:88652611-88652633 GAGGGGACAGGGGAGGAGGAAGG - Intronic
1131212545 15:90510372-90510394 CAGGGCACAGGGGAGGGTGAGGG - Intergenic
1131386433 15:92012021-92012043 GAAGCCTCAGAGGAGAAGGAGGG + Intronic
1131624662 15:94104680-94104702 GAAGGCACGGGGGAAGAGGAAGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132567710 16:630928-630950 CAGGGCAGAGGGGAGGAGGTTGG - Exonic
1132626650 16:894562-894584 CAAGGCGCAGAGAGGAAGGACGG + Intronic
1132709487 16:1260060-1260082 CAGGGCAGAGAAGAGGTGGAAGG - Intergenic
1133050383 16:3114160-3114182 CAAGGCACACGGGAAGTGGATGG - Intronic
1133270375 16:4608431-4608453 CAAGGGGCAGAGGACGAGGCAGG - Intergenic
1133290190 16:4715391-4715413 CAAAGCTCAGAGGAGGAGGCGGG + Intronic
1133520231 16:6549388-6549410 CGAGGGAGGGAGGAGGAGGAGGG + Intronic
1133724220 16:8522571-8522593 CCAGGGACAGTGGACGAGGAGGG - Intergenic
1134122747 16:11596555-11596577 GGAGGCAGAGGGGAGGAGGAGGG + Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134459640 16:14420205-14420227 CATTGCACAGAGGTGGATGAAGG + Intergenic
1134841473 16:17405332-17405354 CAAGGCCCAGTGGAGGGAGAAGG + Intronic
1134892878 16:17856539-17856561 CAAGGCAGAAAGGAGGAGTATGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135476662 16:22782459-22782481 CAAGGAACAGAGGAGCTGAAGGG - Intergenic
1135497947 16:22969079-22969101 GAAGGTTCAGATGAGGAGGAAGG - Intergenic
1135816415 16:25638318-25638340 CAAGGCAGATGGGAGGAGGATGG - Intergenic
1136027315 16:27477202-27477224 GAAGGGACAGAGGAAGAGGAGGG - Intronic
1136239881 16:28937267-28937289 CCAGGCCCAGAAGAAGAGGAAGG + Exonic
1136749133 16:32617050-32617072 GGAGGCACAGAGGTGGAGGGAGG - Intergenic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1137375369 16:47947566-47947588 GAAGGAAAAGAGGAGGGGGAAGG - Intergenic
1138352365 16:56352783-56352805 CAAGGTGCAGAGCAGGAGGTGGG + Intronic
1138395159 16:56698404-56698426 GGAGGGACAGTGGAGGAGGAAGG - Intronic
1138552720 16:57756271-57756293 CAAGGAACAAAGGAGGAGAGGGG - Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139067910 16:63341928-63341950 CAAGACACAGAGGAAGAAAAGGG - Intergenic
1139511830 16:67432133-67432155 CTGGGCACAGAGGACCAGGAGGG - Intronic
1139582119 16:67879978-67880000 CAAGGGTCAGAGATGGAGGATGG + Intronic
1141195118 16:81854607-81854629 TAAGGCACAGGGAAGGAGAAAGG - Intronic
1141273995 16:82568503-82568525 CAAGGCACTGAGCAGCAAGAAGG - Intergenic
1141434099 16:83989381-83989403 TGAGAAACAGAGGAGGAGGAGGG - Intronic
1141469696 16:84229964-84229986 AAAGGGACAGATGAGGAGGCAGG + Intronic
1141714012 16:85716616-85716638 AGAGGAAGAGAGGAGGAGGAGGG + Intronic
1142035599 16:87860776-87860798 CAAGGCCCAGAATAGGAGGTCGG + Intronic
1142162777 16:88567589-88567611 GAAGTCACAGAGGAGTAGCACGG + Intergenic
1203051266 16_KI270728v1_random:876264-876286 GGAGGCACAGAGGTGGAGGGAGG - Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142606374 17:1083642-1083664 CAGGGAACAGAGGGAGAGGAGGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142756796 17:2021274-2021296 GAAGCCCCAGAGGAGGAGGAAGG - Intronic
1142762825 17:2051535-2051557 CCAGGAACTGAGGAGGGGGAAGG - Intergenic
1142773250 17:2115117-2115139 GAAGACACAGCTGAGGAGGATGG + Intronic
1142805048 17:2367139-2367161 CAGGGCACAGAAGAGGGGAAGGG - Intronic
1142993475 17:3747230-3747252 CAAGTCAGAGAGAAAGAGGAGGG + Intronic
1143476742 17:7207511-7207533 CCAGGCCCAGAGGCGGAGGTAGG + Intronic
1144305213 17:13963750-13963772 CAAGGGAAAGGGGAGGATGAAGG - Intergenic
1144459730 17:15448716-15448738 CAAGCTTCAGAGGAGGAGGAAGG - Intronic
1144469998 17:15530428-15530450 AATAGCACAAAGGAGGAGGAAGG - Intronic
1144537626 17:16106348-16106370 CAAGCCACAAAAGAGTAGGAAGG + Intronic
1144766616 17:17736437-17736459 CAAGGAACAGAGGAACAGGCGGG + Intronic
1144867266 17:18344740-18344762 CAGTGCACAGAGGATAAGGAAGG + Intronic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1144926346 17:18813223-18813245 AATAGCACAAAGGAGGAGGAAGG + Intergenic
1144957578 17:19026963-19026985 CCAGGCAGAGAGGATGAGGCAGG - Intronic
1144965980 17:19077622-19077644 AAAGGCTCACTGGAGGAGGAGGG + Intergenic
1144977578 17:19147553-19147575 CCAGGCAGAGAGGATGAGGCAGG + Intronic
1144981988 17:19174567-19174589 AAAGGCTCACTGGAGGAGGAGGG - Intergenic
1144986235 17:19203672-19203694 AAAGGCTCACTGGAGGAGGAGGG + Intergenic
1145015113 17:19391592-19391614 CCAGGCACAGAGGAGGATGTGGG - Intergenic
1145093763 17:20008163-20008185 AAAGGAAGAGAGGAAGAGGAGGG - Intergenic
1145104326 17:20102779-20102801 TAAGGCAAGGAGGAGGAGGGAGG - Intronic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145974703 17:28977409-28977431 CATGGCACCGAGGTGGAGGGTGG + Intronic
1146055062 17:29576824-29576846 CAGGGCACAGGGGAGTGGGAAGG + Intronic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146327906 17:31902836-31902858 CAAGGCACAGAGGTGGAACATGG - Intergenic
1146456952 17:33015990-33016012 CTTGGCAAAGAGGAGGACGAAGG - Exonic
1146487821 17:33258403-33258425 TAAGGGACAGAGAAGGAGGATGG + Intronic
1146762195 17:35488339-35488361 TAATGCACAGGGGAGGAGGGAGG + Intronic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146884384 17:36461477-36461499 AAAGGCCCAGTGGAGGATGAGGG - Intergenic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147319297 17:39636406-39636428 CCAGGCACCCAGGAGGAGCAAGG - Exonic
1147393250 17:40122573-40122595 CCGGGCACCGAGGCGGAGGAGGG - Intronic
1147442911 17:40458329-40458351 CAAGGCACAGAGGTGTGGGAGGG - Intergenic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147610217 17:41797599-41797621 AAAGGAAGAAAGGAGGAGGAAGG - Intergenic
1147882485 17:43663002-43663024 CATGGCCCAGAGCAGCAGGATGG + Intergenic
1147883626 17:43669974-43669996 CAAAGCAGAGGGGTGGAGGAAGG + Intergenic
1147970183 17:44215215-44215237 CAAGGAACTGAGGTGCAGGAGGG - Intronic
1148031126 17:44621821-44621843 CATGGGACAGAGGATGAGTATGG - Intergenic
1148546957 17:48526463-48526485 GAAAGCAGGGAGGAGGAGGAAGG - Intergenic
1148601248 17:48895744-48895766 CATGGCGAAGAGGATGAGGAAGG - Exonic
1149433804 17:56616779-56616801 CAAAGCACAGGGAAGGAGCAAGG - Intergenic
1149501199 17:57153749-57153771 AAAGAGACAGAGGAGGAGGGGGG - Intergenic
1149626199 17:58082817-58082839 CAAAGAACAAAGGAGGAAGAAGG + Intergenic
1149979348 17:61297267-61297289 CCAGTCACAGAGGAAGAGGCTGG + Intronic
1150597221 17:66616820-66616842 GGAGGCACAGAGGAGGGAGAGGG + Intronic
1150791847 17:68205625-68205647 GAAGGGAAAGCGGAGGAGGAGGG - Intergenic
1151299914 17:73216523-73216545 CAAGGCAGAGAGGAGGTGAGTGG + Intronic
1151405878 17:73885771-73885793 CAGGGCACAGAAGAGCAGGGAGG - Intergenic
1151540620 17:74763020-74763042 CAAGGCCCAGAGAAGGAAGTCGG + Intronic
1151770533 17:76157407-76157429 AAAGGCACAGAGCAGGAAGTCGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1151850720 17:76688112-76688134 GAAGGGCCTGAGGAGGAGGACGG - Exonic
1152188722 17:78875281-78875303 CAAGGGACAGATGCTGAGGAAGG + Intronic
1152238347 17:79149856-79149878 CAGGCCCCAGAGGAGGAGGCTGG - Intronic
1152330106 17:79667822-79667844 CAAGGCACAGAGGCGGATGGAGG + Intergenic
1152463459 17:80453110-80453132 GAAGTCACAGAGAAGGAGGAGGG - Intergenic
1152673087 17:81620701-81620723 CAAGCAACAGAAGAGAAGGAAGG + Intronic
1152696569 17:81800615-81800637 CAAGGGGCTGATGAGGAGGAGGG - Intergenic
1152753543 17:82077586-82077608 CAAGGCACAGAGGTGGGTGGGGG - Intergenic
1153051453 18:906154-906176 ACAGGCGCAAAGGAGGAGGAAGG + Intronic
1153184765 18:2473717-2473739 AAAGGGAGAGGGGAGGAGGAAGG + Intergenic
1153299914 18:3583381-3583403 GAAGACAGAGAGGAGGAGGAAGG - Intronic
1153424439 18:4946287-4946309 CAAAGCACTGAGAAGGAGCATGG + Intergenic
1153711866 18:7808294-7808316 GAGGGCACAGAGGAGAAGCAGGG + Intronic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1155057486 18:22197711-22197733 CCAGGCACAGAGGAGGCTCAGGG + Intronic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1155279848 18:24228307-24228329 CAAAGTATAGAGGAGGAGTAAGG - Intronic
1155367567 18:25063761-25063783 GAAAGCACAGAGGAGGAGAGTGG - Intronic
1156080577 18:33329822-33329844 AAAGGAAAAGAGGAAGAGGAAGG - Intronic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157470487 18:47984416-47984438 CAAGTCTCTGAGAAGGAGGATGG - Intergenic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157622322 18:49023786-49023808 CCAGGCATGGAGGAGGAGGAAGG - Intergenic
1157634571 18:49138437-49138459 CAAGGCCCCTAGGAGGTGGAGGG - Intronic
1158374668 18:56849347-56849369 CAAGAAACAGAGGAGGAATAAGG - Intronic
1159056498 18:63470919-63470941 GATGGTACAGAGGAGGAGAAGGG + Intergenic
1159350676 18:67268885-67268907 CAAGGAATAGAGGAGAAGGTGGG - Intergenic
1159959661 18:74545653-74545675 AACAGCAGAGAGGAGGAGGAGGG - Intronic
1159962810 18:74568570-74568592 GAAGGCACTGAGGAGGTGGGAGG + Intronic
1160080668 18:75724271-75724293 CAAAGCATAAATGAGGAGGAGGG + Intergenic
1160345759 18:78130553-78130575 CACGACACAGAGGAGGAGTGAGG + Intergenic
1160391714 18:78539132-78539154 CAAGGAACAGAGGCTGAAGAGGG + Intergenic
1160754604 19:750986-751008 CAAAGTCCAGAGGAGGAGGAGGG - Intergenic
1161040782 19:2109814-2109836 CAAGGTAGAGGGGAGGCGGAGGG + Intronic
1161185335 19:2914876-2914898 AACAGCACAGAGGAGGAGGGTGG - Intronic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161233925 19:3188790-3188812 CAGGGCGCAGATGAGGAGCATGG - Intronic
1161268360 19:3375526-3375548 TAAGGCAAAGGGGAGGTGGAGGG - Intronic
1161390194 19:4016699-4016721 CCAGGCAGAGAGGAGGGGGCAGG + Intronic
1161395330 19:4042438-4042460 CAATCCACAGAGGAGGAGCTGGG + Intergenic
1161404023 19:4081862-4081884 AGAGGCAAAGAGGAGGAGGGAGG - Intergenic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1161948630 19:7454687-7454709 CAAAGACCAGAGGAGGAGGACGG - Intronic
1162144887 19:8607524-8607546 TTTTGCACAGAGGAGGAGGAGGG - Intronic
1162329982 19:10021855-10021877 CTAGGCACAGAGGAGGGGAGGGG - Exonic
1162782602 19:13014316-13014338 CAGGGCCCAGAGGCGGGGGAGGG - Intronic
1162846581 19:13397364-13397386 CAAGAAACAGAGGAGGTGGGTGG + Intronic
1162870771 19:13584945-13584967 CAAGAGACAGAGGAGGTGAAAGG + Intronic
1163497021 19:17652535-17652557 CAGCCCAGAGAGGAGGAGGAGGG - Intronic
1163568984 19:18069142-18069164 CAAGGCCCAGAGCAGGAAGCGGG + Intronic
1164493376 19:28735459-28735481 CAAGGCACTGAGGAGAAACAGGG + Intergenic
1164777001 19:30860678-30860700 GAAGGCTCAAAGGAGGAGGCAGG + Intergenic
1164844038 19:31416652-31416674 CAAGACACAGAGGAAGAAGATGG + Intergenic
1165346750 19:35253425-35253447 GAAGGCAGAGAGGAAGGGGAGGG + Intronic
1165362387 19:35344943-35344965 CAAGGGATAGAGGAGGTGGTGGG - Intronic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165742419 19:38211841-38211863 CAAGGGACAGAGAGGGAGGGAGG + Exonic
1165976223 19:39679143-39679165 GAAGGCACAGATGAGGATGATGG - Intergenic
1166008932 19:39926984-39927006 AAAGCCACAGAGGAGTAGGTGGG + Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1166979408 19:46623887-46623909 CATGGCAAAGAGGATGAGCATGG + Exonic
1166992456 19:46700820-46700842 CACGCCAGTGAGGAGGAGGAAGG - Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167317814 19:48776269-48776291 GAGGGCACAGGGGAGGTGGAAGG - Intergenic
1167685970 19:50956808-50956830 CAAGGCACAGAGGGGGTCCATGG - Intergenic
1168182354 19:54670975-54670997 CCATGGAAAGAGGAGGAGGAAGG + Intronic
1168257756 19:55175886-55175908 CCAGGCACAGTGGGGGAGGTGGG + Intronic
1168294508 19:55372365-55372387 CACCGCACAGAGGTGGAGGCAGG + Intergenic
1168380281 19:55914308-55914330 CAAGGCACATGGTAGGAGGCTGG + Intronic
1168719115 19:58545123-58545145 AAAGGCAGAGAGTAGGGGGAGGG - Intronic
925128089 2:1476090-1476112 CTGGGCACTGAGGAGTAGGAAGG - Intronic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925474481 2:4197634-4197656 AAGGGCACAGATGAGGAGGCAGG + Intergenic
925799022 2:7578381-7578403 CAAGGCACCTGGGAAGAGGAAGG - Intergenic
926653486 2:15371791-15371813 CAATGAACAGAGGCTGAGGAGGG + Intronic
927139090 2:20117823-20117845 CCAGGCACTGAGGAGGAGCCCGG + Intergenic
927413871 2:22856339-22856361 TAGGCCACACAGGAGGAGGAAGG + Intergenic
927419639 2:22916720-22916742 CAAGGCAGAGGGTAGCAGGAGGG + Intergenic
927862709 2:26570190-26570212 CAGGGAGCAGAGGAGGAGTATGG + Intronic
928534544 2:32227372-32227394 CAAGGAACAGAGGAGGTGGAAGG - Intronic
928759278 2:34562194-34562216 CATTTCACAGAGGAGGAGAATGG + Intergenic
929245516 2:39697820-39697842 CACGGAACAGAGGAGGAGATGGG + Intronic
929444330 2:41991150-41991172 CCAGGCACTGAGCAGGAAGATGG - Intergenic
929986432 2:46737886-46737908 CAAAGCACATAGGAGAGGGATGG - Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930203456 2:48565730-48565752 GTAGGGACAGAGGAGGAGAAAGG + Intronic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930559566 2:52943935-52943957 GAAGGCAGAGAGTTGGAGGAGGG - Intergenic
931020419 2:58038442-58038464 TAAGGCAGAAAGGAGGAGGCCGG - Intronic
931259552 2:60605256-60605278 CCAGGTCCATAGGAGGAGGAGGG - Intergenic
931501829 2:62877050-62877072 AAAGGCACAGAAGAGCAGGTTGG + Intronic
931902801 2:66807658-66807680 GAAGGCAAAGAAGGGGAGGAAGG + Intergenic
931924958 2:67062253-67062275 GAAGGCAGAGAGGAAGAAGATGG + Intergenic
932222424 2:70010052-70010074 GAAGTCACAGAGCTGGAGGAGGG + Intergenic
932365352 2:71148796-71148818 CAAGGAACAGAGGAAGGGAAGGG - Intronic
932839875 2:75072179-75072201 CAGGGCACAGAGGGAGAGAAGGG + Intronic
933571789 2:84022429-84022451 CAAGAGACTGAGGATGAGGAGGG + Intergenic
933772448 2:85753255-85753277 CAAGTCACAGAGGCAGAGGAGGG - Intronic
933991838 2:87639571-87639593 AAAGGCAGAGGGGAGGAGAAAGG - Intergenic
934121477 2:88844479-88844501 CATGGCACTGAGCAGGAGGCAGG + Intergenic
934509795 2:94928464-94928486 CAAGTAAAAGAGGAGGCGGACGG + Intergenic
934553659 2:95276636-95276658 CAAGTCTCAGAGGAGCTGGATGG + Exonic
935108967 2:100074270-100074292 GGAGGAACAGAGCAGGAGGAGGG - Intronic
935223170 2:101032233-101032255 CCAGATACACAGGAGGAGGAAGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935411387 2:102767972-102767994 AAATGAACAGAGGAGGAGGAAGG - Intronic
935802032 2:106707449-106707471 CAAGTCACAGAGGGGAGGGATGG - Intergenic
935802635 2:106714203-106714225 CACAGCACAGAGGAGAAGAAGGG + Intergenic
936144223 2:109968747-109968769 GAAGGGACAGAGGAGGGGAAGGG - Intergenic
936180907 2:110266707-110266729 GAAGGGACAGAGGAGGGGAAGGG - Intergenic
936200465 2:110402722-110402744 GAAGGGACAGAGGAGGGGAAGGG + Intergenic
936302009 2:111311247-111311269 AAAGGCAGAGGGGAGGAGAAAGG + Intergenic
937112717 2:119378784-119378806 CAAGAGAGTGAGGAGGAGGAGGG - Intergenic
937160845 2:119759828-119759850 GAAGAGATAGAGGAGGAGGAGGG + Exonic
937224065 2:120358052-120358074 AAAGGTGCAGAGGTGGAGGATGG - Intergenic
937225301 2:120365413-120365435 CAAGGCACAGAGGCACAGGGGGG - Intergenic
937234653 2:120423402-120423424 CAATGGAAAGAGGAGGAGGGAGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937400190 2:121575750-121575772 AGAGGCAGAAAGGAGGAGGACGG + Intronic
937646623 2:124272581-124272603 CATTGCACAGAAGAGGAAGAAGG + Intronic
938204573 2:129408297-129408319 TAAAGCACAAAGGAGGAGGGAGG - Intergenic
938344752 2:130559123-130559145 CTCGGCACTGAGGAGGAGGCGGG - Intergenic
938345081 2:130561597-130561619 CTCGGCACTGAGGAGGAGGCGGG + Intergenic
938618103 2:133020728-133020750 CAAGACACAGGCTAGGAGGAAGG + Intronic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
939487413 2:142832152-142832174 CAAGGTACAGAGGGGCAGGAGGG + Intergenic
939499529 2:142965583-142965605 TAAGGCAGAGAGAAGGAAGAAGG + Intronic
940214047 2:151286523-151286545 GGAGAGACAGAGGAGGAGGAGGG - Intronic
940616872 2:156059782-156059804 GAAGGCAGTGGGGAGGAGGAAGG + Intergenic
941104821 2:161340920-161340942 GAAGGGCCTGAGGAGGAGGACGG - Intronic
942086679 2:172450282-172450304 CAAAGAACAGATGTGGAGGACGG + Intronic
942307939 2:174627134-174627156 CAGAGCACAGTGGTGGAGGATGG - Intronic
942388770 2:175470147-175470169 CAAAAAAGAGAGGAGGAGGAGGG - Intergenic
943699075 2:190970626-190970648 GAAGGAACAGAGTAGCAGGAGGG + Exonic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
943746533 2:191468108-191468130 AAAAGCACAGTGGGGGAGGAAGG - Intergenic
944529062 2:200649758-200649780 GAAGGCACAGGGGAGGAGAAGGG - Intronic
944979012 2:205092482-205092504 CTAGGAACAGAGGAGGAGAAGGG + Intronic
945304073 2:208241975-208241997 CAAGGTACAGAGGTGGAGCCTGG - Exonic
945404804 2:209432276-209432298 GAAGGCACATAAGAGTAGGAAGG - Intronic
946408301 2:219504308-219504330 GAAGGGAGAGGGGAGGAGGAAGG - Intronic
946864917 2:224034335-224034357 CAATGAACACAGGAGGAGAAAGG + Intronic
947058952 2:226140028-226140050 CATGGCACAGAGCAGGAAGGTGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947224137 2:227823936-227823958 AAAGGGACAGAGGATGGGGATGG + Intergenic
947637885 2:231689230-231689252 AAAGACACAGAGGTGGGGGAAGG - Intergenic
947705865 2:232275054-232275076 CAAGGCAGGAGGGAGGAGGAAGG - Intronic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
947826027 2:233106607-233106629 AGAAGCCCAGAGGAGGAGGAGGG - Intronic
947829135 2:233126370-233126392 CAAGTGAGAGAGTAGGAGGAGGG - Intronic
947830187 2:233134144-233134166 AAAGTCAAGGAGGAGGAGGAAGG + Intronic
947967067 2:234290542-234290564 CCAGGTAGAGAGGAGCAGGAAGG + Intergenic
948036061 2:234858985-234859007 CCAGGCTCAGAGGAGGAGATGGG + Intergenic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948237740 2:236403113-236403135 GAAGGCAAGGAAGAGGAGGAGGG + Intronic
948421026 2:237859901-237859923 CAGGGCACAGGGGAGGCGGAGGG + Intronic
948460556 2:238128091-238128113 CGAGGCCCTGAGGAGGAGGACGG - Intronic
948615318 2:239194789-239194811 CCAGCAACTGAGGAGGAGGAGGG + Intronic
948636384 2:239340469-239340491 CATGGGACAGAGGAGGACCATGG + Intronic
948691201 2:239706257-239706279 AGAAGCTCAGAGGAGGAGGATGG - Intergenic
948691881 2:239711415-239711437 CCAGGGACAAAGGAGGAGGAGGG - Intergenic
948890195 2:240903653-240903675 CAAGGCTAAGAGGAGGTGGGCGG + Intergenic
1169229144 20:3875547-3875569 AAAGGCACAAGGGAGGTGGAGGG + Exonic
1169266623 20:4171061-4171083 CCAGGCAGGGAAGAGGAGGAGGG - Intronic
1169313862 20:4571664-4571686 CAAGGCACAGGAGAGGAAGCAGG + Intergenic
1169717854 20:8640820-8640842 CATGGCACAGAGTAGAAGAACGG - Intronic
1169778997 20:9288671-9288693 TAAAGGACAGAGGAGGTGGAGGG + Intronic
1170442863 20:16396283-16396305 ACAGGGACAGAGGAGGGGGATGG - Intronic
1170822452 20:19765959-19765981 CCAGGCACAGATGGGGAGAATGG + Intergenic
1170835317 20:19878895-19878917 CAAGGTACAGGGGAGGAAGCAGG - Intergenic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171351629 20:24507171-24507193 TAATGGACAGAGGTGGAGGATGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172627685 20:36357514-36357536 CAAGGCAGGGAGGAAGAGCATGG + Intronic
1172846475 20:37932447-37932469 CAAGGCAAGCAGGAGGAGCAGGG + Intronic
1173162715 20:40664296-40664318 GGAGACCCAGAGGAGGAGGAGGG - Intergenic
1173310952 20:41895459-41895481 CCAGGGACAGAGGAGGAGGGAGG - Intergenic
1173410437 20:42804780-42804802 GAAGGCAGAGATAAGGAGGAGGG - Intronic
1173807992 20:45938744-45938766 CCAGGCAGAGAAGAGGGGGAGGG + Intronic
1173863486 20:46299170-46299192 CAGGGCACAGAGGACATGGAGGG - Intronic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1173940623 20:46908042-46908064 GGAGGCACAGTGGAGGAGAATGG - Intronic
1175120271 20:56711143-56711165 CAAGGAGGAGAGGAGGAGGGAGG - Intergenic
1175150508 20:56930144-56930166 GAAGGGACAAAGGGGGAGGAGGG + Intergenic
1175561207 20:59932884-59932906 GAAGGCGCCGAGCAGGAGGAAGG + Intronic
1175942211 20:62542667-62542689 CCAGGCACGGTGCAGGAGGACGG + Intergenic
1176341059 21:5696588-5696610 CGAGGCTCAGAGCAGGAGCAAGG + Intergenic
1176473313 21:7128741-7128763 CGAGGCTCAGAGCAGGAGCAAGG + Intergenic
1176503768 21:7627868-7627890 CGAGGCTCAGAGCAGGAGCAAGG - Intergenic
1177423256 21:20889823-20889845 CAAGGCAGAGAAGAGGAAGAAGG - Intergenic
1177528414 21:22328810-22328832 GATGGCACAGAAGAAGAGGATGG - Intergenic
1178191161 21:30282649-30282671 CAGGGCACAGAGGAGTTTGACGG + Exonic
1178450344 21:32692642-32692664 GAAAGCACACAGGAGAAGGAAGG + Intronic
1179137822 21:38696169-38696191 CATGGCAGAGCTGAGGAGGAAGG + Intergenic
1179721992 21:43321385-43321407 CAAGGCAGTGAAGGGGAGGAGGG - Intergenic
1179799255 21:43803249-43803271 AAAGGCACAGAGGAGTAGGCAGG - Intronic
1179992814 21:44957473-44957495 CAAGGCACAGGGCAGATGGATGG - Intronic
1180347524 22:11716322-11716344 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1180355289 22:11834432-11834454 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1180382962 22:12157895-12157917 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1180695923 22:17751613-17751635 CCAGGCAGAGAGGAGGTGGCAGG + Intronic
1181014758 22:20062467-20062489 AGAGGCCCAGAGGAGAAGGAGGG - Intronic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181137853 22:20781532-20781554 CAAGGCACAGAGCAGGTGTGTGG - Intronic
1181542382 22:23580309-23580331 CAGGGACCAGAGGATGAGGATGG - Intergenic
1181645106 22:24226660-24226682 CAAGGGGCAGAGGTGGAGGCTGG - Exonic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1183215339 22:36475867-36475889 GGATGCGCAGAGGAGGAGGAAGG - Intronic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183293396 22:37016493-37016515 TGAGGCTCAGAGGAGGAGAATGG - Intronic
1183332334 22:37228318-37228340 CGGGGCACAGATGAGGAGAAAGG + Intronic
1183338800 22:37266842-37266864 CAAGCCACAGAGGTGGAGACTGG - Intergenic
1183473038 22:38019587-38019609 CAAGGCAGAGAGAGGGAGGGCGG + Intronic
1183520690 22:38294603-38294625 CAGGGCACAGAAGGGGAGGGAGG + Intronic
1183624290 22:38992195-38992217 CAAGGCACAGGGGAGCGGGGAGG - Intronic
1183646023 22:39127234-39127256 GAAGGGTCAGAGGAGGAAGAAGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183748212 22:39704351-39704373 AAGGGCACAAAGGTGGAGGAGGG + Intergenic
1184067962 22:42130846-42130868 CCAGGCACAGAGGACCAGGCAGG + Exonic
1184070699 22:42144519-42144541 CCAGGCACAGAGGACCAGGCAGG + Intergenic
1184072581 22:42155056-42155078 CCAGGCACAGAGGACCAGGCAGG + Intergenic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184266016 22:43346510-43346532 CGAGGCACAGACGTGGAGGTGGG - Intergenic
1184407248 22:44307142-44307164 CAAGGCCCACAGGAGGATGGAGG - Intronic
1184424934 22:44403804-44403826 CAAGGCTGAGAGGAGGGAGAAGG + Intergenic
1184664796 22:45982564-45982586 CAAGACACAGAGGAGGACCCTGG - Intergenic
1184742677 22:46438180-46438202 CAAGGCCCAGAGAAGGGGGCCGG + Intronic
1184843209 22:47064614-47064636 CCAGGCCCTGAGGAGGACGAGGG - Intronic
1184912789 22:47547454-47547476 CTAGGTGCAGAGCAGGAGGAGGG - Intergenic
1184931301 22:47683148-47683170 CAAGGCACAGAGAAGAACCATGG - Intergenic
1184971855 22:48028132-48028154 CAGGGCACAGAGGGAGTGGAAGG + Intergenic
1184976535 22:48066311-48066333 CCAGGCTGAGAGGAGGAGGCAGG - Intergenic
1185089346 22:48757134-48757156 AGAGGCAAGGAGGAGGAGGAGGG + Intronic
1185127548 22:49019910-49019932 CAAGCCACAGATGTGGAGCAGGG + Intergenic
1185209694 22:49563741-49563763 CAAGGAAGAGAGGGGGAGGAGGG + Intronic
1185338034 22:50279511-50279533 GAATCCACAGAGGAGGTGGACGG + Intronic
1203240325 22_KI270733v1_random:11046-11068 CGAGGCTCAGAGCAGGAGCAAGG + Intergenic
949113442 3:291166-291188 CAAGGTAAAGAGGAAGAGGTTGG + Intronic
949981925 3:9507602-9507624 AAAGGCAAAGAGGAAGAGAAGGG + Intronic
950183039 3:10928362-10928384 CAGGGCGCAGAGGAGAGGGATGG + Intronic
950419826 3:12892396-12892418 CGATGCACAGAGCAGGAGGAGGG - Intergenic
950467235 3:13162763-13162785 CGTGGCCCTGAGGAGGAGGAGGG - Intergenic
950541353 3:13615146-13615168 CCAGGCACAGAGGAGGCTAATGG - Intronic
951157194 3:19370075-19370097 CAAGGCAAAGAGGAAGAAGGTGG - Intronic
951760435 3:26141568-26141590 CAAGGCACAGTGGTGGAAGTAGG - Intergenic
951899307 3:27641308-27641330 CAATGCAGAGAGGTGGAAGAGGG + Intergenic
952141752 3:30487077-30487099 TAAGACAGAGAGTAGGAGGAAGG - Intergenic
952295813 3:32061003-32061025 CGAGGGACAGAGCAGGAGCAGGG - Intronic
953178493 3:40574247-40574269 CAAGGCACAGAGAATGAGGGAGG + Intronic
953196550 3:40739516-40739538 CAAGGCAAAGAGGAGAGGGAAGG - Intergenic
953837432 3:46359007-46359029 CAGGGCTGAGAGGAGAAGGAGGG + Intronic
953871319 3:46629791-46629813 GAAGGAAGAGAGGAGGAGGAGGG + Intergenic
953928073 3:46992417-46992439 CAAAGAAGAGAGGAGGAAGATGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954535805 3:51358478-51358500 ACAGGGAGAGAGGAGGAGGAGGG - Intronic
954707726 3:52489926-52489948 CAAGGCAGAGAGGAAGAGAGGGG - Intronic
954707935 3:52491013-52491035 CAGGGCTCAGAGCAGGAGGTAGG + Intronic
954886314 3:53877382-53877404 CAAGGCCTAGAAAAGGAGGAGGG + Exonic
955002190 3:54937828-54937850 CACAGCACAGAGGGTGAGGAAGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955156585 3:56422520-56422542 CAAGGAACAGGCGAGGAGGGAGG - Intronic
955598670 3:60620632-60620654 AAGGGCTCAGAGGAGGGGGAGGG + Intronic
955973178 3:64456229-64456251 CAAGGCAGAGAGAGGGATGAAGG + Intergenic
956665019 3:71633701-71633723 CAAAGCATAGAGGATGAGAAGGG + Intergenic
956774030 3:72550167-72550189 AAAGGACAAGAGGAGGAGGAGGG - Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958963036 3:100528504-100528526 CAAGGGACAGAGGAGGAGGCAGG + Intronic
959143021 3:102508709-102508731 CATGCCACAGAGGATGAAGAGGG + Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
960196523 3:114775490-114775512 CAAGGAAAAGAGGTGGAGTAAGG - Intronic
960230421 3:115219896-115219918 GAAGGCACAGAGGGGGAAAATGG + Intergenic
960970893 3:123139381-123139403 CCAGGCCCAGAGGAGGAGAAAGG - Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961109926 3:124275289-124275311 CAAGTCTCAAAGGAAGAGGAAGG - Intronic
961313175 3:126016684-126016706 CATGGCTGAGAGGAGGAAGAGGG + Intronic
961434623 3:126908305-126908327 CAAAGCACAGAGGAGTCTGAGGG - Intronic
961522732 3:127476650-127476672 GAAGGGAGAGAAGAGGAGGAAGG + Intergenic
961644774 3:128387044-128387066 CAGGGCCCAGGTGAGGAGGATGG + Intronic
961868039 3:129968289-129968311 CAAGGCTCCGAGGGGGAGAAAGG - Intergenic
961919062 3:130407144-130407166 CAAGGCAAAGATGTGGAGGAAGG + Intronic
962762376 3:138527110-138527132 AAAGGCAAAGAGGGGCAGGAGGG + Intronic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
962997520 3:140645930-140645952 AAAGGCACAGAGTAGCAAGATGG - Intergenic
963207624 3:142652566-142652588 GAGGGCACAGAGTAGGAGGCGGG + Intronic
964487899 3:157205296-157205318 TAAGGGACAGAGGAGGTGGGTGG - Intergenic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
965653052 3:170953535-170953557 CAATGCACCGGGGAGGAGAAGGG + Intergenic
966241173 3:177756817-177756839 TAAGTCACAGAGAATGAGGAAGG - Intergenic
966549193 3:181184976-181184998 CAAAGCACAAAGGATGTGGAAGG + Intergenic
966642427 3:182205650-182205672 AAAGGCATAGAGGAGGGAGAGGG - Intergenic
966734891 3:183180471-183180493 AAAGAGACAGGGGAGGAGGAAGG - Intronic
966892470 3:184417354-184417376 CAAGGCCCAGAGGAGGCTGATGG + Intronic
966913201 3:184570591-184570613 CAAGGCCCAGGGGAAGGGGAGGG - Intronic
966934612 3:184697777-184697799 CAAGCCACAAAGGTAGAGGAGGG - Intergenic
966945372 3:184773853-184773875 CAAGGCCCAGCGCAGCAGGAAGG - Intergenic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
967138018 3:186528910-186528932 CAAGGCAGAGAGGCAGAGGATGG + Intergenic
967364842 3:188674414-188674436 CAAGGCAGATTGGAGAAGGAAGG - Intronic
968038265 3:195567067-195567089 AAAGGCAGTGAGGAGGAGGTGGG - Intergenic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
968544103 4:1187710-1187732 GATAGCACAGAGGAGGAGGAGGG - Intronic
968642835 4:1722871-1722893 GAAGGCCCAGAGGAGGAGCTGGG - Intronic
968893993 4:3388187-3388209 CCAGTCACAGAGGAGGAGACGGG + Intronic
969119751 4:4899485-4899507 CAAGGCACAGAGGAAGGAAATGG - Intergenic
969256219 4:6003400-6003422 CCAGGAAGAGATGAGGAGGAGGG + Intergenic
969256345 4:6004487-6004509 CCAGGAAGAGATGAGGAGGAGGG + Intergenic
969444959 4:7239434-7239456 CAAGAGAGAGAGGAAGAGGAGGG - Intronic
969446377 4:7246993-7247015 AAAGGCACAGAGGGCCAGGAGGG - Intronic
969581356 4:8067397-8067419 CATGGCACAGAGGAGCAGCCTGG + Intronic
969604811 4:8197137-8197159 ACAGACACAGAGGAGGAGGCTGG + Intronic
969713509 4:8857802-8857824 CAAGGGCAAGGGGAGGAGGAGGG - Intronic
969725899 4:8917925-8917947 GCAGGGACAGATGAGGAGGAAGG + Intergenic
970096737 4:12472107-12472129 CCAGGCACAGAGCAGGTGCAAGG - Intergenic
970309198 4:14764282-14764304 CAAGCCACAGAGGATGAAGCAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971297746 4:25412952-25412974 CAAAGCACAGTGGAAGAGGGTGG + Intronic
972738786 4:41870809-41870831 TAAGGAACAGAAGAGGAGGAGGG + Intergenic
972760549 4:42098944-42098966 CCAGGCACAGAGAAAAAGGAGGG + Intergenic
972915233 4:43868936-43868958 CATGGCACACAAGATGAGGAAGG - Intergenic
973232999 4:47864391-47864413 CAAGACAGAAAGGCGGAGGAAGG - Intronic
973372876 4:49266186-49266208 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
973388121 4:49528873-49528895 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973711437 4:53633728-53633750 CTTGGCCCAGAGGAGGAAGATGG - Intronic
975384483 4:73739743-73739765 CAAGGCATTGAGGAATAGGAGGG - Intergenic
975807715 4:78130120-78130142 CAAGGTAGAGAGGAAGAGCAAGG - Intronic
976213730 4:82695788-82695810 CTAGGCAAAGAAGAAGAGGAGGG - Intronic
977546830 4:98392932-98392954 CATAACACAGAGGAGGATGATGG + Intronic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
978835616 4:113146012-113146034 TAGGCCACAAAGGAGGAGGAAGG + Intronic
979228886 4:118323507-118323529 AAAGGAAGAGAGGAGGAGGGAGG + Intronic
979882948 4:125986012-125986034 CAAGGGCAAGAGGAGGAGGGTGG - Intergenic
980521017 4:133934568-133934590 AAAGACTCAGAGGAGGAGCAAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980857226 4:138454621-138454643 CAATCCACAGAGGAAGGGGAAGG + Intergenic
980992050 4:139746720-139746742 AAAGGGAGAGAGGAGGAGAAGGG - Intronic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
981936819 4:150248262-150248284 CAGACCACAGAGGAGGAGAAAGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982710691 4:158755956-158755978 CAGGCCAGAGAGGAGGGGGAGGG - Intergenic
983625432 4:169797345-169797367 TAAGGCACAGAGGAGGGGAAAGG - Intergenic
984428707 4:179621162-179621184 CAAGGCACAGGAGGAGAGGATGG - Intergenic
984702830 4:182829065-182829087 GGAGGCAGAGGGGAGGAGGAAGG + Intergenic
984807831 4:183767635-183767657 CAAGACACAGAGGCTGAGGTGGG + Intergenic
985001624 4:185490272-185490294 TAAGTCACAGAGGAGAAGAAAGG + Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985777068 5:1850197-1850219 AAAGGCCCCGAGGAGGAGGGAGG - Intergenic
985778951 5:1859716-1859738 AACGGCACAGAGGATGAGGCAGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986613881 5:9597116-9597138 CCAGTGACAGAGGAGGAGGAAGG - Intergenic
986689976 5:10306362-10306384 GGGGGCAGAGAGGAGGAGGAGGG + Intronic
987118392 5:14744615-14744637 GCAGGAGCAGAGGAGGAGGAGGG + Intronic
987257672 5:16173188-16173210 CAAGCAACAAAGGAGGAAGAAGG + Intronic
987528818 5:19088422-19088444 TAGAACACAGAGGAGGAGGAGGG - Intergenic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
989110497 5:37902392-37902414 TGGGGCCCAGAGGAGGAGGAAGG - Intergenic
989110778 5:37904926-37904948 CAAGGGACAGAGGCAGAGTATGG + Intergenic
989298728 5:39862741-39862763 GAAGGAACAGAAGAGGAGGGAGG - Intergenic
989383788 5:40835126-40835148 AGAGGCACAAAGGACGAGGATGG + Intronic
990393943 5:55356157-55356179 GAAGGCACAGAGAAGGAAGTGGG + Intronic
991421112 5:66443162-66443184 CAAAGCACAGATAAGGAAGATGG + Intergenic
991637663 5:68722493-68722515 TAATGCATGGAGGAGGAGGAAGG + Intergenic
991655523 5:68900250-68900272 CTAGACACAGAGGAGGAGCCAGG - Intergenic
992162650 5:74017658-74017680 GAAGGCACTGAAGATGAGGAGGG - Intergenic
993294455 5:86117606-86117628 CAAGGCAAAGATGTGAAGGATGG + Intergenic
993893123 5:93499010-93499032 CAAGGCAGAGAGGAGAAAAAAGG + Intergenic
994975273 5:106796575-106796597 CAAGGCATAGAGGAAGGGAATGG + Intergenic
995323491 5:110863949-110863971 CAAGGCAAAGAGGAAAAGGTGGG - Intergenic
995420536 5:111962035-111962057 CAAATCCCAGAGGAGGAGGCAGG + Intronic
995421757 5:111975448-111975470 CAATTCAGAGAGGAGGAGAATGG + Intronic
996288180 5:121820001-121820023 CCAGGCACAGATTAGGAGCACGG + Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996814828 5:127563367-127563389 CAAGGCACAGGGGACCAGGAAGG - Intergenic
997265353 5:132491675-132491697 TAGGGAACAGAGGAGGAGAAGGG + Intergenic
997349101 5:133217450-133217472 AAAGGCACAGAGGAGGGTCAGGG - Intronic
997424146 5:133791768-133791790 AACCTCACAGAGGAGGAGGAGGG - Intergenic
997846029 5:137286683-137286705 CAAATCACAGAGCAGGAGGGTGG + Intronic
997964522 5:138346843-138346865 GAAAGCGAAGAGGAGGAGGAGGG + Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998863308 5:146467754-146467776 AAAGGCAAAGATGAAGAGGAAGG - Intronic
999027991 5:148257754-148257776 AAAGGCACAGAGGGCCAGGATGG - Intergenic
999149514 5:149417411-149417433 CAAGACAGAGAGGAAGAGAAAGG - Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999574655 5:152962495-152962517 CAAGGCACAGAGAAGAAGCATGG - Intergenic
1001132974 5:169079774-169079796 GAAGGGGAAGAGGAGGAGGAGGG + Intronic
1001404955 5:171469732-171469754 CAAGGGAGGGGGGAGGAGGAGGG - Intergenic
1001646692 5:173287353-173287375 CAAAGCATAAAGGAGGTGGAGGG + Intergenic
1001692485 5:173643411-173643433 CATGGCAGAGAGGAGGAGATGGG + Intergenic
1001704191 5:173729974-173729996 GAAGGCCCAGAGGAGGAGCCTGG + Intergenic
1001791334 5:174459963-174459985 TCTGGCACAGAGGAGGGGGAAGG - Intergenic
1001838484 5:174852920-174852942 CAAAGGACAGTGGAGGGGGATGG + Intergenic
1002075590 5:176706386-176706408 CAAGGTGCAGACTAGGAGGATGG + Intergenic
1002268025 5:178048609-178048631 AGAGGCACAGAGGTGGAGGGAGG - Intronic
1002643394 5:180641147-180641169 CCGGGCACAGAGGACGAGGGAGG - Intronic
1002884100 6:1278571-1278593 CCTGCCACAGTGGAGGAGGAGGG + Intergenic
1002900313 6:1405298-1405320 CAAGGCACAGATGGAGAGAAGGG - Intergenic
1003203826 6:3989370-3989392 GAAGGAAGAGAGGAAGAGGAAGG - Intergenic
1003222907 6:4177619-4177641 CAAGACACAGAGGAGGGGGGTGG - Intergenic
1003396645 6:5759120-5759142 CATAGCTCAGAGGAGGAGAATGG + Intronic
1003550956 6:7101580-7101602 CCAGGCAGAGAGGAGGGGGCAGG - Intergenic
1003569567 6:7247130-7247152 CAAGGCAGACAAGAGGAAGAAGG + Exonic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004426512 6:15510603-15510625 CAAGACACACAGGAGGATCAAGG - Intronic
1004751596 6:18567516-18567538 GAAGGAAAGGAGGAGGAGGAAGG - Intergenic
1005083652 6:21981694-21981716 CAAAGCAGAAAGGAGGAGGTGGG - Intergenic
1005802428 6:29440623-29440645 AAAGGGGCAGAGGATGAGGAGGG - Exonic
1005822536 6:29609383-29609405 CATGGCACAGGGGAGGAAGAGGG + Intronic
1005913115 6:30327523-30327545 CAAGGAGTAGAGGAAGAGGAAGG + Intronic
1005987491 6:30884006-30884028 CAGGGCACAGAGGAAGAAGCAGG - Intronic
1006354435 6:33546261-33546283 TAAGGCACAGATGAGGAAGGAGG + Intergenic
1006403006 6:33828741-33828763 CCAGGCAGAGAGGAGGCTGAAGG - Intergenic
1006576898 6:35053224-35053246 CAACCCAAAAAGGAGGAGGAGGG + Intronic
1006731135 6:36236916-36236938 CTAGGCAGAAAGGAAGAGGAAGG - Intergenic
1006899414 6:37490364-37490386 AAAGGAAGAGGGGAGGAGGAAGG + Intronic
1006989093 6:38198158-38198180 AAAGAGACAGAGGAGGAGAAAGG + Intronic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007585419 6:42986138-42986160 AAAGGCACGGATGAGGAGCAGGG - Intronic
1007748527 6:44057716-44057738 GAAGGCTCTGAGGATGAGGAGGG - Intergenic
1007781920 6:44259278-44259300 CAAGGGACTGAGAAGGAGAATGG + Exonic
1007825699 6:44599036-44599058 GAAGGGACAGAGGAGAAGGGAGG + Intergenic
1008399072 6:51042896-51042918 CAAGGCAGAGGGGTGGAGAAGGG - Intergenic
1008777015 6:55052148-55052170 GAAGGCAGAGAGGGGAAGGAAGG - Intergenic
1009593666 6:65708583-65708605 GAAGGGAAGGAGGAGGAGGAAGG - Intergenic
1009844501 6:69119327-69119349 CAAGGCACATAGTAGGAGTTTGG + Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1011405944 6:87015660-87015682 AATGACACAGAGGTGGAGGATGG - Exonic
1011438112 6:87360117-87360139 CCACGCACAGAGGAGGAGCAGGG - Intronic
1011840907 6:91497805-91497827 GGAGGAAAAGAGGAGGAGGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013078273 6:106790134-106790156 CAAAGCACAGAGGAAAATGACGG + Intergenic
1013496197 6:110699944-110699966 CAAGCCACACAGCAGGAGGTGGG + Intronic
1013618486 6:111867043-111867065 CCAGGAACAGAGGAGGAGTCAGG - Intronic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014644388 6:123954984-123955006 TAAAGCACAGAAGGGGAGGAGGG + Intronic
1015217337 6:130765519-130765541 GAATGCACTGAGGAGGAGGAGGG - Intergenic
1016295127 6:142565629-142565651 CAAAGCAGACAGGAGGAGTAAGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016931029 6:149409609-149409631 CAAGACACAGAAGATGATGAGGG + Exonic
1017442028 6:154473544-154473566 CAAGGCACAGAAGAGGAATGAGG + Intronic
1017764938 6:157599252-157599274 CCAGGAACAGTGGAGGAGGCTGG + Intronic
1018105323 6:160480718-160480740 CAAGGCACAGAAGGAGAGGAAGG - Intergenic
1018152623 6:160954607-160954629 GAAGGGAAAGAGGAGGAGAAGGG - Intergenic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018676463 6:166226469-166226491 CAAGGCTCAGAGGACAAGGTTGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018863794 6:167732242-167732264 CAAGCCACAGAGCGGGAGGTGGG - Intergenic
1018866024 6:167747709-167747731 GAAGGAAGGGAGGAGGAGGAGGG + Intergenic
1018938921 6:168295075-168295097 CAAACAGCAGAGGAGGAGGAAGG - Intronic
1018960959 6:168448321-168448343 GATGGCACTGGGGAGGAGGATGG + Intronic
1019047448 6:169159923-169159945 CCAGGCATTGAGGAGAAGGAAGG - Intergenic
1019419058 7:942305-942327 GGAGGAAGAGAGGAGGAGGAAGG + Intronic
1019419063 7:942323-942345 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419076 7:942378-942400 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419081 7:942396-942418 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419086 7:942414-942436 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419091 7:942432-942454 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419096 7:942450-942472 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419107 7:942491-942513 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419112 7:942509-942531 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419122 7:942557-942579 GGAGGAAGAGAGGAGGAGGAAGG + Intronic
1019419127 7:942575-942597 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419132 7:942593-942615 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419137 7:942611-942633 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419148 7:942652-942674 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419153 7:942670-942692 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419162 7:942702-942724 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419167 7:942720-942742 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419172 7:942738-942760 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419183 7:942779-942801 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419188 7:942797-942819 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419197 7:942829-942851 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419202 7:942847-942869 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419213 7:942888-942910 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419218 7:942906-942928 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419236 7:942988-943010 GGAGGAAGAGAGGAGGAGGAAGG + Intronic
1019419241 7:943006-943028 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419250 7:943038-943060 GAAGGGAGAGACGAGGAGGAAGG + Intronic
1019419261 7:943079-943101 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419266 7:943097-943119 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419276 7:943145-943167 GGAGGAAGAGAGGAGGAGGAAGG + Intronic
1019419280 7:943163-943185 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419285 7:943181-943203 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419298 7:943233-943255 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419308 7:943267-943289 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419312 7:943285-943307 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419317 7:943303-943325 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419322 7:943321-943343 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419333 7:943362-943384 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419338 7:943380-943402 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419350 7:943427-943449 GGAGGAAGAGAGGAGGAGGAAGG + Intronic
1019419370 7:943505-943527 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419375 7:943523-943545 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419388 7:943570-943592 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419393 7:943588-943610 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419398 7:943606-943628 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419403 7:943624-943646 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419415 7:943671-943693 GGAGGAAGAGAGGAGGAGGAAGG + Intronic
1019419435 7:943749-943771 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419440 7:943767-943789 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419449 7:943799-943821 GAAGGGAGAGAGGAGGACGAAGG + Intronic
1019419454 7:943817-943839 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019531792 7:1506872-1506894 GAAGGCAAAGAGGTAGAGGAGGG - Intergenic
1020273802 7:6613057-6613079 CAGGTCAGAGAGGAGAAGGAGGG + Intergenic
1021228468 7:18056780-18056802 CAAGGCACAGAAGTGGATGGAGG - Intergenic
1021532601 7:21665112-21665134 AAAGGCACTGAGAGGGAGGAAGG - Intronic
1021580032 7:22142761-22142783 CAATCCACAGAGGTGGGGGATGG + Intronic
1021803584 7:24332772-24332794 CAAAGCACAAAGGAGAAGTAGGG + Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022499260 7:30872336-30872358 TGAGGGACAGAGGAGGGGGAAGG - Intronic
1022508542 7:30921513-30921535 GCAGGCACAGAGGAGAAAGAGGG + Intronic
1022736490 7:33081022-33081044 TAAGGCACAGAGGGGTGGGAGGG + Intergenic
1022822969 7:33979458-33979480 CTAAGCACAGAGGAGGAGGGAGG - Intronic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1023814339 7:43938166-43938188 CAAGGTACAGAGCTGGAAGAGGG - Intronic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024246364 7:47473080-47473102 CAGGGCACGGTGGAGGACGATGG - Intronic
1024874738 7:54009042-54009064 CAGGGCACAGAGGATGGGAATGG - Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1028888580 7:95961651-95961673 CCAGGGACAGAGGATGAGGTTGG + Intronic
1029309633 7:99650706-99650728 GAAGGTAGAGAGGAGGAGGAGGG - Intronic
1030585127 7:111408858-111408880 CAAAGCACAGATGTAGAGGAAGG + Intronic
1031419089 7:121528188-121528210 TAAGAAAGAGAGGAGGAGGATGG + Intergenic
1032055686 7:128682428-128682450 AAAGCCACAGAGGAGGAGGAGGG - Intronic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1032525040 7:132573643-132573665 GAAGGCACAGAGAAGGAGAAAGG + Intronic
1032619116 7:133509522-133509544 CCAGGGAGAGAGGAAGAGGAAGG - Intronic
1032702497 7:134394914-134394936 CAAAGGATTGAGGAGGAGGAAGG + Intergenic
1032790941 7:135242044-135242066 GAAGGAAGAGAAGAGGAGGAAGG + Intronic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1034420361 7:150987404-150987426 CAGGGCCCAGATGAGGAGGCTGG + Intergenic
1034441954 7:151090173-151090195 CCCGGCACAGGGGAGGAGCAGGG + Intronic
1034564557 7:151902707-151902729 AGAGGCACAGTGGGGGAGGAAGG - Intergenic
1034702873 7:153111437-153111459 CAGGGGACAGAGGAGGCGCAGGG + Intergenic
1034962877 7:155373422-155373444 CGAGGAACCGAGGAGGAGGGAGG - Intergenic
1035217633 7:157380669-157380691 CAAGAGACAGAAGAGGAAGAAGG - Intronic
1035369259 7:158368647-158368669 CAAGGCACAGAGCAGCTGGGGGG + Intronic
1035458607 7:159025319-159025341 CAAGGGAGAGATGAGGAGGAGGG - Intergenic
1035959411 8:4120429-4120451 TGAGACAGAGAGGAGGAGGAAGG - Intronic
1036235923 8:7039410-7039432 AAAGGCAGAGAGGAGGGTGAGGG + Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036702025 8:11019251-11019273 CAAGTCAGAGAGGAGAGGGAGGG - Intronic
1037071528 8:14656316-14656338 GGAGGGATAGAGGAGGAGGAAGG - Intronic
1037587882 8:20290391-20290413 AAAGACAAAGAGGAGAAGGAAGG + Intronic
1037649352 8:20822516-20822538 CAAGGCTCTGGGGAGGAGGGGGG + Intergenic
1037753234 8:21696089-21696111 GAGGGGACAGAGGAGGGGGAGGG - Intronic
1037880262 8:22570203-22570225 CCAGGGACAGAGGGGGAAGAAGG + Intronic
1038309811 8:26437730-26437752 CAAGCCACAGATGTGGAGGGCGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038886090 8:31664365-31664387 CAACGCATAGAGTGGGAGGAAGG + Intronic
1039069227 8:33634591-33634613 AAAGGCAAAGAGGAGAGGGAGGG + Intergenic
1039317287 8:36387740-36387762 GAAGGGGAAGAGGAGGAGGAGGG - Intergenic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1039451460 8:37677999-37678021 CAAGGCATAGAGGCAGAGAAGGG - Intergenic
1040307940 8:46221929-46221951 CCAGGCACAGGGGAGAAGCATGG + Intergenic
1040892419 8:52330966-52330988 CAAGGCACAGGGGAAGGGGCAGG + Intronic
1042454842 8:68989200-68989222 CAAGGCGAACAGGAAGAGGAAGG + Intergenic
1043185030 8:77137810-77137832 CAAGGCAAAGAGCAGCATGAAGG - Intergenic
1045206124 8:100042969-100042991 CAAGTCAGAATGGAGGAGGAAGG - Intronic
1045211709 8:100106181-100106203 CCCTGCCCAGAGGAGGAGGAAGG - Intronic
1045326242 8:101119682-101119704 CAACTCACAGCGCAGGAGGAGGG - Intergenic
1045478049 8:102569702-102569724 AAAGGAAGAGAGGGGGAGGAGGG - Intergenic
1045987405 8:108264574-108264596 CATGGCTGAGAGCAGGAGGAAGG - Intronic
1046036511 8:108848433-108848455 AAAGGAACAGGGAAGGAGGAAGG + Intergenic
1046239344 8:111470797-111470819 CAAGGGACAGAGGCTGAGGGGGG + Intergenic
1046246107 8:111565187-111565209 CATTGCACAGAGGAGGATCATGG + Intergenic
1047114578 8:121826775-121826797 GAAGGCAGAGAAGAGGGGGAAGG - Intergenic
1047221915 8:122925679-122925701 CAAAGCCTAGAGGTGGAGGAGGG + Intronic
1048742147 8:137572980-137573002 CAAGGAACAGAAGAGGCAGAAGG + Intergenic
1048859236 8:138711663-138711685 CCAGCCCCAGAGAAGGAGGATGG + Intronic
1048879967 8:138864078-138864100 CATCCCACAGAGGAAGAGGAGGG + Intronic
1048886924 8:138916212-138916234 CAGGGCACAGATGAGGGGGCTGG + Intergenic
1048904482 8:139074711-139074733 GAAGGGACAGTGCAGGAGGAAGG + Intergenic
1048926689 8:139278025-139278047 CAGGGCACAGATGTGGAGGCTGG + Intergenic
1049029352 8:140023010-140023032 CAGGGCCCACTGGAGGAGGAGGG + Intronic
1049195282 8:141312398-141312420 CGAGGCACAGAGGAGAGGAAGGG - Intergenic
1049654357 8:143791290-143791312 CCAGGCCCGCAGGAGGAGGATGG - Exonic
1049699731 8:144004826-144004848 CAAGGCACAGACTGGGAGCAGGG + Intronic
1050099445 9:2102893-2102915 GAAGACAGAGAGGTGGAGGATGG - Intronic
1050593589 9:7184059-7184081 CAAGGCCCTGAGGAGGGGCATGG + Intergenic
1050857832 9:10383989-10384011 GAAGACAGAGAGGAGAAGGATGG + Intronic
1050929737 9:11308172-11308194 GAAAGGACAGAGGAGGAAGAAGG - Intergenic
1050936600 9:11404683-11404705 CTAGCCTCAAAGGAGGAGGAGGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051222612 9:14866316-14866338 CAAGGCACTGAGGAGCAAAAAGG - Intronic
1051486319 9:17612209-17612231 GAAGGCACAGAGGAACAGGGAGG + Intronic
1051634724 9:19171266-19171288 GCAGGCAAAGAGGAGAAGGATGG + Intergenic
1051686950 9:19667813-19667835 CCAGGCAGAGAGGAGCAGCACGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052963186 9:34318411-34318433 GAAGGCGCTGAGGAGCAGGAGGG - Intronic
1053131614 9:35618679-35618701 CAAGGCAGCCAGGAGGAGGGTGG - Intronic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053655607 9:40215785-40215807 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1053905970 9:42845001-42845023 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054367725 9:64362015-64362037 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054528999 9:66160507-66160529 CAAGTAAAAGAGGAGGTGGATGG + Intergenic
1054675342 9:67851750-67851772 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054745771 9:68852616-68852638 CAGGGCACAGAGCAGGGTGAAGG + Intronic
1054881834 9:70152102-70152124 AAAGGCACAGGGGAGGCAGAAGG - Intronic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1056496843 9:87164491-87164513 CCAGGCAAAGAGTTGGAGGAGGG - Intergenic
1056543602 9:87594955-87594977 CCAAGCACAGAGGTGGAGGTGGG - Intronic
1056551505 9:87656782-87656804 CAAGGGACAGAGTGGGAGGTGGG + Intronic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1057209108 9:93189930-93189952 CCGGGCACAGAGGAGGTGCATGG + Intronic
1057317233 9:93977470-93977492 CAGGGCGCAGAGCAGAAGGAAGG - Intergenic
1057811889 9:98263874-98263896 GAAGGCAAAGAGGGTGAGGAGGG - Intergenic
1058085264 9:100741309-100741331 GAAGGCAGAGAGTAGAAGGATGG - Intergenic
1058155151 9:101506600-101506622 CTAGATACAGAGGAAGAGGACGG + Intronic
1058169113 9:101657719-101657741 CATGCCACAGAGGTGGTGGATGG + Intronic
1058824649 9:108764170-108764192 GAAGACACGGAGGAGGTGGAAGG - Intergenic
1059322511 9:113480649-113480671 CCAGGCAAAGAGGAGCAGGGAGG + Intronic
1059419362 9:114181397-114181419 CAAGGAAGAGAGGAAGAGGGAGG + Intronic
1059421535 9:114195505-114195527 CAGGCCACACAGGAGCAGGAGGG - Intronic
1060279248 9:122204852-122204874 AAAGGCACAGAGAAGAAGGGTGG + Intronic
1060299619 9:122367623-122367645 GTAGGTAAAGAGGAGGAGGAAGG + Intergenic
1060335476 9:122717852-122717874 CAAGGCACAGAGGACCAGATAGG + Intergenic
1060521717 9:124297844-124297866 CAAGGCAAAGGGGACGTGGAAGG - Intronic
1060554437 9:124500973-124500995 AAAGGCAGGGTGGAGGAGGAAGG - Intronic
1060943763 9:127558047-127558069 CCAGGAAAAGAGGAGGGGGAAGG - Intronic
1061011820 9:127960459-127960481 ACAGCCACAGAGGAGGAGAATGG + Intronic
1061423263 9:130483737-130483759 GAAGGCAAGGAGGAGGAGCAAGG - Intronic
1061499603 9:130994219-130994241 AAAGGCTCAGAAGCGGAGGATGG - Intergenic
1061898924 9:133663035-133663057 CAAGGGCCAGACAAGGAGGAGGG + Intergenic
1061953504 9:133949542-133949564 GCAGGTACAGAGGAGGAGAAAGG - Intronic
1061956135 9:133962157-133962179 CTGGGCACAGAGGGGGATGAAGG + Intronic
1062141983 9:134964326-134964348 CAGTGCCCAGTGGAGGAGGAGGG + Intergenic
1062231961 9:135486835-135486857 CACGGCAGAGAGGATGAGGCAGG + Exonic
1062477948 9:136738649-136738671 AGAGCCACAGAGGAGCAGGAGGG - Intronic
1062634149 9:137481135-137481157 CCAGGCACCAAGGAGGAGGAAGG + Intronic
1203422008 Un_GL000195v1:1405-1427 CGAGGCTCAGAGCAGGAGCAAGG - Intergenic
1203696590 Un_GL000214v1:104212-104234 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1203552630 Un_KI270743v1:176816-176838 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1185653486 X:1666161-1666183 CAAGAGACAGAAGAGGAGGCCGG - Intergenic
1185754624 X:2643431-2643453 AAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1186366851 X:8904537-8904559 GAAGGAAAAGAGGAGGAGGTTGG - Intergenic
1186430105 X:9497892-9497914 AAAGAAAGAGAGGAGGAGGAAGG - Intronic
1186998780 X:15153418-15153440 CCAGGCACACAAGAGCAGGAAGG + Intergenic
1187013372 X:15302501-15302523 GAAGGCCCAGAGGAAAAGGAGGG + Intronic
1187356178 X:18573994-18574016 CAAGGCACGCAGGAGGAAAAAGG - Intronic
1188129255 X:26410782-26410804 AAAGGCACAGATGGGGAAGATGG + Intergenic
1188627155 X:32298809-32298831 GAAGGCACCCAGCAGGAGGAGGG + Intronic
1189110646 X:38286225-38286247 GAAGGGAAAGGGGAGGAGGAAGG - Exonic
1189160354 X:38804017-38804039 CAGGGCAGAGCAGAGGAGGAGGG - Exonic
1189551533 X:42098754-42098776 CATGGCAGAGAGGATGAGAAAGG + Intergenic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1192058019 X:67793096-67793118 CAGGGCACAGAAGAGGAGCCAGG - Intergenic
1192130003 X:68540941-68540963 TAAGGAACATAGGAGGAGCAGGG - Intergenic
1192772549 X:74207802-74207824 AAAGGCGCAGAGAGGGAGGAAGG + Intergenic
1194487209 X:94499061-94499083 CTAAGCATAGAGGAGGAGTATGG + Intergenic
1194488463 X:94516355-94516377 CAGGGCACAGAGGAATTGGAGGG + Intergenic
1194806304 X:98332443-98332465 TAGGGGGCAGAGGAGGAGGAGGG + Intergenic
1195385861 X:104313217-104313239 GGAGGCACAGAGAGGGAGGAAGG - Intergenic
1195486676 X:105416351-105416373 CAAGGCACAGAGGCAGAAGTGGG - Intronic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1197110690 X:122770944-122770966 TAAGGCACTGAGGAGAAGCAGGG - Intergenic
1198039919 X:132840423-132840445 GAAGGGGAAGAGGAGGAGGAGGG - Intronic
1198083845 X:133264723-133264745 CAAGGCCAATAGGAGGAGAAGGG - Intergenic
1198557659 X:137812337-137812359 CAAAGCAGAGTGGAGAAGGAAGG + Intergenic
1199478596 X:148273484-148273506 TAAGGCTCGGAGGAGGACGAGGG + Intergenic
1199579166 X:149344437-149344459 GATGGCACAGGGGAGGAGGAAGG + Intergenic
1199590254 X:149461113-149461135 CATCGCACAGATGAAGAGGATGG - Intergenic
1199855583 X:151756389-151756411 AAAGACAGAGAAGAGGAGGATGG - Intergenic
1200819323 Y:7566085-7566107 GAAGGGAAAGAGGAGGAGAAGGG + Intergenic