ID: 1156962036

View in Genome Browser
Species Human (GRCh38)
Location 18:43043977-43043999
Sequence AGACATGCCCAGAGGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156962031_1156962036 3 Left 1156962031 18:43043951-43043973 CCATAGCACAGGATCTTTCCCAA 0: 1
1: 0
2: 1
3: 21
4: 146
Right 1156962036 18:43043977-43043999 AGACATGCCCAGAGGAAGCATGG 0: 1
1: 0
2: 1
3: 37
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156962036 Original CRISPR AGACATGCCCAGAGGAAGCA TGG Intronic
900693880 1:3998158-3998180 AGACAGGCCCAGTGGTTGCACGG - Intergenic
901181070 1:7342244-7342266 CGACCTGTCCAGAGGCAGCAAGG + Intronic
901186208 1:7375093-7375115 AGACAACCCCAGGGGATGCAGGG - Intronic
901439966 1:9271969-9271991 AGACATGCCCAGAGCCTGCAAGG + Intergenic
901449337 1:9326450-9326472 AGGCATGACCAGAGGGAACAGGG + Intronic
902287536 1:15416282-15416304 TGACATCCCCTGAGGCAGCAAGG - Intronic
902919722 1:19658510-19658532 AGCGAGGCCCAGAGGCAGCAGGG + Intergenic
903225913 1:21894226-21894248 AGCCATGCCCAGGGGGAGGAGGG + Intronic
903590394 1:24451303-24451325 AGACATGCCCACAGTACTCACGG + Intronic
903957161 1:27033503-27033525 AGACATGCCCAGAGAAGGGCTGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906155740 1:43612982-43613004 AAACAGGCCTGGAGGAAGCAAGG - Intronic
906695550 1:47820997-47821019 ACAGATGCCCAGAGGATGCAAGG - Intronic
907276966 1:53322026-53322048 AGACAGGAGCAGGGGAAGCAAGG + Intronic
907983240 1:59505531-59505553 TGCCAAGCACAGAGGAAGCAGGG + Intronic
908209536 1:61886220-61886242 AGGCATGAACAGAGGAAGAAAGG + Intronic
908419561 1:63946770-63946792 CAACATGCCTTGAGGAAGCAAGG - Intronic
909180955 1:72423326-72423348 AGTCCTGCCCAGAGAAATCAGGG - Intergenic
910292645 1:85614367-85614389 AGGCATGCCCAGGAAAAGCATGG + Intergenic
910487379 1:87730424-87730446 AGTCATGCCCAGAGGCAGGAGGG - Intergenic
911829016 1:102526510-102526532 ATGCATGTCCAGAGGAAGAATGG + Intergenic
912109262 1:106319905-106319927 AGACATGGCCAGTGGGAGAAAGG - Intergenic
913660486 1:121002557-121002579 AGAGATGGCCACAGGAACCATGG + Intergenic
914011849 1:143785714-143785736 AGAGATGGCCACAGGAACCATGG + Intergenic
914165983 1:145175420-145175442 AGAGATGGCCACAGGAACCATGG - Intergenic
914453586 1:147815051-147815073 GGAGATGCCCAGGAGAAGCATGG - Intergenic
914650477 1:149694374-149694396 AGAGATGGCCACAGGAACCATGG + Intergenic
915069100 1:153251318-153251340 ACACATGCCCAGGGGAATCCTGG + Intergenic
915162329 1:153929369-153929391 AGACATGGTCAGGGGACGCAGGG + Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
919336700 1:196244749-196244771 GGACTTGCCCAGAATAAGCAGGG + Intronic
919806637 1:201384555-201384577 AGAGCTGCTCAGAGGAGGCAGGG - Intronic
920386205 1:205571665-205571687 AGAGCTGCCCAGAGTCAGCAAGG - Intronic
920446791 1:206023927-206023949 AGCCATGCCCAGAGTAAATACGG + Intergenic
921975189 1:221194497-221194519 AACCATGCCCAGGGGCAGCATGG + Intergenic
922494287 1:226043767-226043789 AGACATGCATAGAGGAAAGATGG - Intergenic
923525652 1:234770512-234770534 GGACATGGCCTGAGGAAGCCTGG + Intergenic
923604038 1:235427289-235427311 AGAGATGCTGTGAGGAAGCAAGG - Intronic
924656476 1:245977321-245977343 AGCCATGCCATGAGGGAGCAAGG - Intronic
924683187 1:246259437-246259459 AGTCATACCCATAGGAAGCAGGG - Intronic
1062760887 10:17711-17733 AGCCATGCCCATAGGAAAAAGGG + Intergenic
1064495532 10:15906135-15906157 AGCCAGGCACAGAGGAATCAGGG - Intergenic
1067264037 10:44721525-44721547 AGATGTTCCCTGAGGAAGCAGGG - Intergenic
1068726069 10:60304929-60304951 AAACAGGCACAGAGCAAGCAGGG - Intronic
1069697560 10:70398191-70398213 AGACAGGACCAGAGGGAACAGGG + Intergenic
1069758223 10:70786793-70786815 AGACAGGCCCAGAAAAAGCCAGG - Intergenic
1069923787 10:71834066-71834088 ACAGAGGCCCAGAGGCAGCATGG + Intronic
1070403610 10:76075307-76075329 AGACATGCAAAGAGGCATCAGGG + Intronic
1070736900 10:78869295-78869317 AGACAAGCGCAGAGGAATCCAGG + Intergenic
1071079259 10:81790545-81790567 AGACAGGCCTAGAGGAGGAAAGG + Intergenic
1072733332 10:97862974-97862996 AGACGGGCCCAGGGGTAGCAGGG + Intronic
1074044573 10:109825744-109825766 AAACTTGCCCAAAGGTAGCAAGG + Intergenic
1074340336 10:112622297-112622319 AGACACACCCAGCTGAAGCAAGG + Intronic
1075072428 10:119327788-119327810 AGACATGAGCAGGTGAAGCAAGG + Intronic
1076295813 10:129383492-129383514 AGACAAGCACAGAGGAAAGACGG - Intergenic
1077942501 11:6858266-6858288 AGACTTGCCTAGAGGAATCAGGG - Intergenic
1078799139 11:14625058-14625080 AGAAAAGCCCATAGGAAACATGG + Intronic
1081666896 11:44921878-44921900 AGACATGCCCAGGAGAGGAAAGG - Intronic
1082888924 11:58117777-58117799 AGACATTCCCAAAGGTAGGATGG + Intronic
1083353551 11:62048256-62048278 AAACAGCCCCAGGGGAAGCAGGG + Intergenic
1083551478 11:63593414-63593436 TGGCATGCCAAGAGGCAGCAAGG + Intronic
1083647945 11:64184011-64184033 ACAGCTGCCGAGAGGAAGCAGGG - Intergenic
1084025326 11:66444810-66444832 AGCCTGGCCCAGAGGAAGCAAGG + Intronic
1084164361 11:67368145-67368167 AGACTCACCCATAGGAAGCAAGG + Intronic
1084566425 11:69931382-69931404 TGCCAGGACCAGAGGAAGCAGGG - Intergenic
1084770019 11:71336609-71336631 AGGCTTGCCCAGAGGCAGCACGG + Intergenic
1086261770 11:84948427-84948449 AGACATGACCAAAGAAAGCAAGG + Intronic
1086343809 11:85874998-85875020 AGACATGCGAAGAGTGAGCAAGG + Intronic
1087699914 11:101424089-101424111 AGAAATTCACAGTGGAAGCATGG - Intergenic
1088448768 11:109960593-109960615 AGTCAAGGGCAGAGGAAGCAGGG + Intergenic
1089301159 11:117499428-117499450 AAACAGGCCCAGAGAAAGGAAGG + Intronic
1089683915 11:120134825-120134847 ACACAGGCACAGAGGAAGGAAGG - Intronic
1089732602 11:120528505-120528527 AGACAGGCTCAGAGGAAAGAAGG - Intronic
1090307226 11:125702066-125702088 AGACCTGCCCAGAGGCTGCCTGG + Intergenic
1090476309 11:127024551-127024573 AGTCCTGCCCAGAGAAATCATGG - Intergenic
1091836635 12:3590860-3590882 AGGCAGGCACCGAGGAAGCAAGG + Intronic
1092335015 12:7624700-7624722 AGCCATGCTCACAGGGAGCAGGG - Intergenic
1092980448 12:13789436-13789458 AAACTTGCCCAGGGGATGCAGGG - Intronic
1096575825 12:52552293-52552315 AGTCTCGCCCAGAGTAAGCAGGG - Intronic
1098385061 12:69909770-69909792 AGGCATGTCCAGGGGAAGGAGGG + Intronic
1099060822 12:77905972-77905994 AGAAGTGACCAGAGGGAGCAAGG - Intronic
1100410339 12:94311206-94311228 AGGCATGCCCAGAGAGGGCATGG + Intronic
1101308003 12:103549557-103549579 AGACAGGCAGAGAGGAAGAAAGG + Intergenic
1101749382 12:107570870-107570892 ACAGAGGCCCAGAGGAAGCCTGG - Intronic
1101939862 12:109091843-109091865 AGAAAAGCCCACAGGAAGCTAGG - Intronic
1102255161 12:111410751-111410773 AGAGATGCCCACGGGAAGCAGGG - Intronic
1104067537 12:125317767-125317789 AGAGCTCCCCAGATGAAGCAAGG - Intronic
1104128599 12:125871414-125871436 AGAAGTGCACAGAGGCAGCAAGG + Intergenic
1106420315 13:29580369-29580391 AGAAAAGCAGAGAGGAAGCACGG - Intronic
1106802225 13:33267896-33267918 AGATAAGCCCAGAAGAAGCCTGG - Intronic
1106820469 13:33458762-33458784 AGAAGCGCCCAGAGGAAGAATGG - Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1110226323 13:73123182-73123204 AGACAAGCCAAGAGGAACCATGG + Intergenic
1110452924 13:75657069-75657091 AGACATGCACAGAGGGATGAAGG + Intronic
1111311047 13:86486730-86486752 AGAGATGATCACAGGAAGCAGGG + Intergenic
1111503348 13:89154931-89154953 ATACATGCAGAGAGAAAGCATGG + Intergenic
1111859840 13:93689001-93689023 AGACTTGCCCAGGGGAACCTAGG + Intronic
1112103567 13:96216687-96216709 ACAGGTGCCCAGAGGAAGCTTGG + Intronic
1113029219 13:105975559-105975581 AGTCATGCCCAGTGGGAGGATGG - Intergenic
1113718474 13:112533016-112533038 AGCCAAGCCCAGAGGCAGCTGGG + Intronic
1117625225 14:57629743-57629765 AGACAGGAACACAGGAAGCAGGG + Intronic
1118073129 14:62268161-62268183 AGAGATGCCAAGAAGAAGAAAGG + Intergenic
1118707683 14:68495176-68495198 AGTCATGCCCAGGAGAAGCAAGG - Intronic
1119007199 14:70942666-70942688 TGGCATGCCCAGAGACAGCATGG - Intronic
1120045732 14:79803475-79803497 AGACATACCCAGTGGGAGGAAGG - Intronic
1120078578 14:80188417-80188439 GGACAGGCCCAGAGGAAGGAAGG - Intergenic
1120718685 14:87867587-87867609 AGAACAGCCCAGAGAAAGCATGG + Intronic
1121400325 14:93670549-93670571 TGGCATGCCCAGAGAAGGCATGG - Intronic
1121912871 14:97807908-97807930 AGACTGGCACAGAGGAGGCATGG - Intergenic
1122352481 14:101104077-101104099 AGCCAGGCCCAGAGGTAGGATGG + Intergenic
1122768432 14:104086391-104086413 ACACAGGGGCAGAGGAAGCAGGG - Intronic
1124464231 15:29921581-29921603 AGGCAAGCCCACAGGAACCATGG - Intronic
1125512055 15:40297420-40297442 AGACACTCCCAGAGGATGCTAGG - Intronic
1125520302 15:40344643-40344665 GGAGAAGCCCACAGGAAGCAGGG + Intergenic
1126262586 15:46711732-46711754 AGACCTGCTCATTGGAAGCAGGG - Intergenic
1128216609 15:65938583-65938605 AGGCATCCCCAGCAGAAGCATGG - Intronic
1128302768 15:66577269-66577291 AGACAGCCTCAGAGGATGCATGG - Intergenic
1128496487 15:68201272-68201294 AAAAAGGCCCAGGGGAAGCAGGG + Intronic
1128631519 15:69273206-69273228 AGTCATGGCCAGAGAAGGCAGGG - Intergenic
1129237762 15:74234045-74234067 AGACATGGCATGAGGAAGCAGGG + Intergenic
1131271641 15:90950760-90950782 CGACAGGCCAAGAGGCAGCACGG + Intronic
1131435621 15:92419246-92419268 AGGCAGGCTCAGAAGAAGCAGGG + Intronic
1131640489 15:94287452-94287474 AGATATGCCCAGAGAAAATAAGG - Intronic
1132247296 15:100307431-100307453 AGAGATGGCAAGAGCAAGCAAGG + Intronic
1133332203 16:4981789-4981811 AAACAGGCCCAGAGAAAGGAAGG + Intronic
1133344710 16:5062193-5062215 AGAGGTGTGCAGAGGAAGCAGGG - Intronic
1133401504 16:5490620-5490642 AGGAGTGCCCAGAGGAACCAAGG - Intergenic
1134222111 16:12362996-12363018 AGACTTGGGCAGAGGGAGCATGG - Intronic
1134265119 16:12685879-12685901 TGACAACCCCAGAGGAAGAAAGG - Intronic
1135143598 16:19942287-19942309 ATAAATTCCCAGAAGAAGCAGGG + Intergenic
1135762102 16:25145886-25145908 AAACATACCCAAAGAAAGCAAGG - Intronic
1135947415 16:26877254-26877276 AGAGATGCCCAGACTGAGCAGGG + Intergenic
1136294832 16:29295584-29295606 AGACATGGTGGGAGGAAGCAGGG - Intergenic
1137324198 16:47416742-47416764 AGGCTTCCCCAGAAGAAGCATGG + Intronic
1137391534 16:48085364-48085386 AGACCTCCCCAGGGGAAGCCTGG + Intronic
1137487987 16:48907559-48907581 AGAGAGGCCCAAAGGAAGCTGGG + Intergenic
1137495839 16:48968593-48968615 TGGCATCCCCAGAGGGAGCAAGG + Intergenic
1138646930 16:58432364-58432386 AGAACTGTCCCGAGGAAGCAAGG + Intergenic
1138776836 16:59733560-59733582 AGTCCTGGCCAGAGCAAGCAGGG + Intronic
1139454271 16:67059758-67059780 AGAGACCCCCAGAGTAAGCAGGG - Intronic
1141208713 16:81956597-81956619 AAGCATGCCCAAAGGGAGCATGG - Intronic
1141569963 16:84928409-84928431 AGTCATGCCCAGATGAACCTGGG - Intergenic
1142277020 16:89124448-89124470 ACACATGCGCAGAGTACGCACGG - Intronic
1143397565 17:6614288-6614310 ACACGTGCACAGAGGAAGCCAGG + Intronic
1147348390 17:39820931-39820953 TGGCATGCCCAGAGAAAGTATGG + Intronic
1149546177 17:57505394-57505416 AGAAAACCCCAGAGAAAGCATGG + Intronic
1149782145 17:59406460-59406482 AGACACGTCCAGGGGAAGCTGGG - Intergenic
1151459122 17:74244220-74244242 AAACAGGCCCAGAGAAAGGAAGG + Intronic
1152953794 18:18065-18087 AGCCATGCCCATAGGAAAAAGGG + Intergenic
1156962036 18:43043977-43043999 AGACATGCCCAGAGGAAGCATGG + Intronic
1157121269 18:44913464-44913486 AGACATGCATAGAGGGTGCAGGG + Intronic
1157396276 18:47344309-47344331 AGACATCCCCAAAGGAAGTAAGG - Intergenic
1157789625 18:50520136-50520158 AGAAACGCACAAAGGAAGCAAGG + Intergenic
1158591913 18:58785156-58785178 TCACTGGCCCAGAGGAAGCAAGG + Intergenic
1158870441 18:61681937-61681959 AGACATGGCCAGGGGAATGAAGG + Intergenic
1160039432 18:75332652-75332674 AGACATGCAAAAAGGCAGCAGGG + Intergenic
1160442019 18:78900210-78900232 AGACATGCACACAGGACACAGGG + Intergenic
1160840890 19:1146667-1146689 AGAGCTGCCGAGAGGAAGCTGGG + Intronic
1161719282 19:5894295-5894317 GGACAGGCCCAGAGAAAGGATGG + Intronic
1164541830 19:29127248-29127270 AGACAGGCACTCAGGAAGCATGG + Intergenic
1165283511 19:34817633-34817655 ACACATGAGCAGAGGAAACATGG - Intergenic
1165362328 19:35344653-35344675 AGGGAGGCCCAGAGCAAGCAGGG + Intronic
1165618092 19:37219704-37219726 AGAGTTACCCAGAGGAAGAATGG + Intronic
1165830174 19:38726784-38726806 AGACATTGGCAGAGGCAGCAGGG + Intronic
1166293108 19:41875947-41875969 AGACATGCTCAAAGGAAACTGGG + Intergenic
1166329114 19:42068708-42068730 AGACATGCCGAGAGCAACCTGGG + Intronic
1166360956 19:42252877-42252899 AGACCTGCACGGAGGAAGCTTGG + Intronic
1166563539 19:43749230-43749252 TGACTAGCACAGAGGAAGCAGGG + Intronic
1166634551 19:44438791-44438813 TGACATGCCCAGAGAGGGCATGG + Intronic
1166838389 19:45681585-45681607 AGCCCTGCCCAGAGGAGGCGCGG - Exonic
1167207501 19:48112463-48112485 AGCCAAGCCCAAAGGAACCATGG + Intergenic
1167539612 19:50076955-50076977 AGCTTTGCCTAGAGGAAGCACGG + Intergenic
1167561965 19:50231360-50231382 AGAAGTGCCCAGAGCAGGCAGGG - Intronic
925253411 2:2461824-2461846 TGACAAGCCCAGTGGAAACAGGG + Intergenic
925392582 2:3507137-3507159 AGACATGTCCATGGGGAGCAGGG + Intronic
926695094 2:15765610-15765632 ACACGGGCCCAGAGGAAGAAAGG - Intergenic
928855315 2:35796439-35796461 AGATCTGCCCTGAGGAAGCATGG + Intergenic
930034283 2:47075869-47075891 AGCAATGCCCAGAGGCAGCAGGG - Exonic
930892866 2:56411491-56411513 ATAAATGCCTAGAGGGAGCAGGG + Intergenic
931239198 2:60437585-60437607 AGTCAAGCCCAGATGGAGCAAGG + Intergenic
931884396 2:66599909-66599931 AGATATGCCCACAGGAAGCTAGG - Intergenic
936050656 2:109221154-109221176 AGTCATGCACAGAGGAACCATGG + Intronic
936061613 2:109298651-109298673 AGGCCTGGCCAGAGGGAGCACGG - Intronic
937059011 2:118967664-118967686 AGAAATGCCCAGATGAACAATGG - Intronic
938410389 2:131059036-131059058 AGAAATGCAAAAAGGAAGCATGG + Intronic
939399252 2:141669642-141669664 ACAAATTCCCAGAGGAAGGAGGG + Intronic
942083531 2:172424340-172424362 AGACATGCACAGTGCAAGAAGGG - Intergenic
944968950 2:204969228-204969250 ATACATGCTCAGAAGAACCATGG - Intronic
944983234 2:205146088-205146110 AGACTTGCACCCAGGAAGCAAGG - Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945391241 2:209267537-209267559 AGTCAGGGGCAGAGGAAGCAGGG - Intergenic
946581353 2:221131259-221131281 AGACATGTCCAGAGGACACAGGG + Intergenic
947453550 2:230231490-230231512 AGAGAAACCCAGAGAAAGCAGGG - Intronic
947738942 2:232476162-232476184 GGACAAGCCCAGAGCAGGCAGGG + Intergenic
948538802 2:238670117-238670139 AGACATTTCCTGAGGCAGCATGG - Intergenic
948883365 2:240871335-240871357 GGCCAGGCCCTGAGGAAGCAGGG - Exonic
948886858 2:240888952-240888974 AGAAAGGCCCAGAGGATGCTGGG - Intronic
1170355673 20:15489606-15489628 AGCTATGCCCAGAGGACCCATGG - Intronic
1170794677 20:19536313-19536335 AGACCTGCCCAGAGGAACTTTGG + Intronic
1170949786 20:20926259-20926281 AGAAGTGGCCTGAGGAAGCATGG + Intergenic
1171352971 20:24518897-24518919 AGACACACCCCGAGGAAGCAGGG + Intronic
1173076952 20:39828347-39828369 AGACATGCACACAGGGAGAATGG + Intergenic
1175659034 20:60796478-60796500 AGAAAAACCCAGGGGAAGCAAGG - Intergenic
1175857627 20:62131060-62131082 AGAGATGCCTAGAGGAACCGGGG + Intronic
1177197085 21:17914592-17914614 AGACTGGCCTGGAGGAAGCATGG + Intronic
1177296207 21:19179484-19179506 AGCCATGCTTATAGGAAGCATGG - Intergenic
1178425200 21:32473614-32473636 AGAGATGCCCGGAGGAGGCTGGG - Intronic
1178477080 21:32946451-32946473 AGTTATGCCCAGTAGAAGCAAGG + Intergenic
1178914203 21:36698002-36698024 AGACAGGCTCAGAGGACGCAGGG - Intergenic
1180024196 21:45149369-45149391 GGACAGGCCCAGAGACAGCAGGG - Intronic
1180092460 21:45540062-45540084 TGACAGGCCCTGAGGAGGCATGG - Intronic
1180148583 21:45935857-45935879 AGTCCTCCCCAGAGTAAGCACGG + Intronic
1181485949 22:23231913-23231935 AGACAGGGCCAGGGGAACCAAGG - Intronic
1181755684 22:25022843-25022865 AGACCTCCCCAGAGAAAGAAGGG - Intronic
1183085628 22:35485234-35485256 AGAGAGGCCCAGAGTAAACAGGG + Intergenic
1184245607 22:43234465-43234487 AGACAGGCCCAGATGGGGCAGGG - Intronic
1185138146 22:49085339-49085361 AGGGATGCCCAGCAGAAGCAGGG - Intergenic
949383418 3:3470831-3470853 TGACATGCTCAGAGAAAGCAAGG - Intergenic
950077401 3:10196713-10196735 AGACCTGCCCAAGGGAAACAGGG - Intronic
950304004 3:11904605-11904627 AGGCAATGCCAGAGGAAGCATGG - Intergenic
950505876 3:13394159-13394181 AGGCAATGCCAGAGGAAGCATGG + Intronic
950645679 3:14375214-14375236 ATACCTGCCCAGAGGAAGGCTGG - Intergenic
951602090 3:24387866-24387888 AGACAGGCCCAGAGACAGGATGG + Intronic
953696821 3:45166343-45166365 ACACATGACAGGAGGAAGCAGGG - Intergenic
955003760 3:54950799-54950821 AGGGACGCACAGAGGAAGCATGG + Intronic
955098550 3:55824045-55824067 GGACATGCATAGAGGTAGCAGGG - Intronic
955600787 3:60642778-60642800 ACCCAGGGCCAGAGGAAGCAGGG - Intronic
959193314 3:103143337-103143359 AGACATGACCAAAGCAAGAAAGG + Intergenic
960601346 3:119462056-119462078 GGACATGCCCGGTGGAAGGAGGG - Exonic
962073727 3:132058381-132058403 AGACTTGGGCAGAGGAAGCTTGG - Intronic
962468909 3:135687670-135687692 AGGAATGCCCAGAAGAAGAAGGG + Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
964239966 3:154580830-154580852 TGACTTGCCCAGAGTAAGCATGG + Intergenic
964401348 3:156302482-156302504 AGACTTGTCCAGGTGAAGCAAGG + Intronic
964546600 3:157840446-157840468 AGACATGAACAGGGCAAGCAAGG - Intergenic
965369258 3:167840585-167840607 AGAAATGCCCAGAAGAGCCATGG + Intergenic
967787693 3:193515045-193515067 AGACATGATCCCAGGAAGCAAGG + Intronic
968809830 4:2794787-2794809 CCACATGGACAGAGGAAGCAGGG + Intronic
969047387 4:4346237-4346259 AGACAGACCCAGAGGAAGGAAGG - Intergenic
973779445 4:54274466-54274488 AGACATGCACAGGGGCAGCAAGG - Intronic
975699976 4:77055219-77055241 AACCATGGCCAGAGCAAGCATGG + Exonic
977103447 4:92848351-92848373 AGAGATGTGTAGAGGAAGCAAGG - Intronic
979007375 4:115317635-115317657 AGACATGTCCAGTGAAAGCATGG - Intergenic
980851883 4:138393157-138393179 AGAGATGCCCATGGGAGGCATGG + Intergenic
981567444 4:146115719-146115741 GGAGATGACAAGAGGAAGCACGG + Intergenic
982132238 4:152240097-152240119 TGACATGACCAGAGGTCGCAAGG - Intergenic
982147918 4:152417830-152417852 GGAGAAGCCCAGAGGCAGCAAGG - Intronic
982480870 4:155908344-155908366 AGCCATGGCAAGAGAAAGCAGGG - Intronic
983637894 4:169916756-169916778 AGACATGCCCAGCAGAGGCAAGG + Intergenic
984555424 4:181208464-181208486 AAACATGACCAAAGGAAACAGGG - Intergenic
985617517 5:932579-932601 TGGTCTGCCCAGAGGAAGCATGG + Intergenic
986821327 5:11469929-11469951 AGACCAGGCCAGAGGAGGCATGG - Intronic
987753209 5:22067707-22067729 AGACATCCACAGAGGAGGCAAGG - Intronic
989257624 5:39382394-39382416 AGACATGCACACGGAAAGCAGGG + Intronic
991667329 5:69012233-69012255 AGACATTCCCCAAGCAAGCAAGG + Intergenic
992097483 5:73376464-73376486 AGACATGTCAAGAGGCAGTATGG - Intergenic
992176800 5:74157169-74157191 AAACATGCCGAGAGGAAACAGGG - Intergenic
992365032 5:76082781-76082803 AGACAAGTCCAGAGGAAACTTGG - Intergenic
992739806 5:79762350-79762372 AGACATGAGCAGAGGCATCAAGG + Intronic
995403517 5:111767861-111767883 AGACCAGCCCAGAGAAAACAGGG - Intronic
995597842 5:113766549-113766571 AGAGATGCCAAGAGGAATCTGGG - Intergenic
996446359 5:123556743-123556765 AAACATGTACAGAGGAAACATGG - Intronic
996933353 5:128917928-128917950 ACAGATGCACAGAAGAAGCAAGG - Intronic
997442516 5:133918855-133918877 AGAGATGCTCAGAGGAGCCAGGG - Intergenic
998155300 5:139783012-139783034 AGACATGACCAGAGGCTGGAGGG - Intergenic
998719432 5:144927584-144927606 AGACATTCCCACAGGATCCAGGG + Intergenic
999393803 5:151213882-151213904 CTACATGCTCAGAGGAAGCCAGG - Intronic
999577833 5:152999670-152999692 AGAAATGCTCAGAGGAAGTCAGG + Intergenic
1001631602 5:173179500-173179522 AGACATCCACAGAGATAGCAGGG - Intergenic
1001644165 5:173268078-173268100 AGAGGTGCCCAGAGGAAGGGTGG - Intergenic
1003260456 6:4511427-4511449 AGAGATGCCGAGAAGAAGCCTGG + Intergenic
1003783537 6:9456751-9456773 AGACATCTCAAGAGGAAGCAGGG + Intergenic
1004039494 6:11961625-11961647 AGACATGGCCCCAGGATGCAGGG + Intergenic
1005161886 6:22873672-22873694 AGACAGCTGCAGAGGAAGCAGGG + Intergenic
1005996618 6:30935079-30935101 AGACACTCCCAGAGGCAGTAGGG - Intergenic
1007287203 6:40756112-40756134 AAACAAGCCCAGAGGAGTCAGGG + Intergenic
1007840029 6:44708561-44708583 AGACATGCACAGAGGAACTGAGG - Intergenic
1007943426 6:45803490-45803512 AGAAATGGCCAGAGAGAGCAGGG - Intergenic
1010157847 6:72815452-72815474 AGACATGAGCAAAGGCAGCAAGG + Intronic
1013017133 6:106170061-106170083 AGACAGGAAAAGAGGAAGCAGGG - Intergenic
1013202703 6:107916181-107916203 AGACATTTCCAGAGGAAGTCAGG - Intronic
1013701322 6:112773747-112773769 AGTGATGCCCAGTGGAAGCCAGG + Intergenic
1014641308 6:123914342-123914364 AGACATGTCGGGAGGAAGCCAGG + Intronic
1015656165 6:135521553-135521575 AGACAAGACCACAGGAAACAGGG + Intergenic
1016800485 6:148163808-148163830 AGAAATTCCCCAAGGAAGCAAGG - Intergenic
1019090928 6:169533092-169533114 AGACCTGCTCAGAGGAAGACAGG + Intronic
1020331811 7:7025979-7026001 AGACATGCCAATAGTCAGCAGGG - Intergenic
1020831984 7:13103899-13103921 AGACATGCACAGAGGGATAACGG + Intergenic
1023131476 7:37007396-37007418 ATCCATGCCCAGGGGAAGCTGGG - Intronic
1023186362 7:37537266-37537288 AGAACTACCCAGAGGAAGCGAGG - Intergenic
1023197433 7:37656699-37656721 AGAGATGACAAGAGGAGGCAGGG - Intergenic
1023278507 7:38546000-38546022 AGTCATTACCAGAGGAAGTAGGG - Intronic
1023767323 7:43523465-43523487 AGAAGAGCCCAGAGGAGGCAGGG + Intronic
1030370518 7:108694397-108694419 AGACATGCCCTGAGCCAGAAGGG - Intergenic
1032005914 7:128301821-128301843 AGACACCCCCACAGGAAGGATGG + Exonic
1032416448 7:131738763-131738785 AGGGATGACCAGAGGAAGAAGGG + Intergenic
1032729866 7:134629870-134629892 TGACATGACCAGAGAAGGCATGG + Intergenic
1033249782 7:139748589-139748611 AGACACGCCCACAGGGACCATGG - Intronic
1034528245 7:151679518-151679540 GCACATGCCTACAGGAAGCAGGG - Intronic
1034736903 7:153437811-153437833 AGACATGCAGAGAGAAGGCAGGG - Intergenic
1035432265 7:158830740-158830762 ACAAATGCCCAGAAGAAGCAGGG + Intergenic
1036056484 8:5260633-5260655 GGAGATGCCCATAGGAAACAAGG - Intergenic
1036524448 8:9521779-9521801 AGACATGCAAAGAAGAAACATGG + Intergenic
1036761413 8:11511613-11511635 AGAGATTCCCAGAGGAAGAAAGG - Intronic
1037826010 8:22161095-22161117 AGACAAGCCCAGAGCAAAGAAGG + Intronic
1037933130 8:22895916-22895938 AAACCTGCCCATGGGAAGCAGGG - Intronic
1038228903 8:25682672-25682694 CTACATGCGCAGAGGAAGTAGGG + Intergenic
1038662078 8:29506104-29506126 AAATCTGCCCAGAAGAAGCAGGG - Intergenic
1040005949 8:42621063-42621085 AGCCCTGCACAGAGGAAGCTAGG - Intergenic
1040831495 8:51681843-51681865 ACTCATGCCCAGTGGAAACATGG - Intronic
1041690708 8:60684265-60684287 TGACATGCACAGAGGAAGCAAGG - Intronic
1041831517 8:62160445-62160467 AGAAATGTCCAGAGGAAAAAAGG + Intergenic
1043670568 8:82880542-82880564 AGAGGTGCCCAGAGCAAGCAAGG - Intergenic
1043850899 8:85215636-85215658 TGGCATGCCCAGAGAGAGCAGGG + Intronic
1044203672 8:89466431-89466453 AAACAGGCCTAGAGAAAGCAAGG - Intergenic
1045420610 8:102011046-102011068 AGACAGACCCACAGGAAACATGG + Intronic
1047431830 8:124799545-124799567 AGACTTGGCCTGAGGAGGCAGGG - Intergenic
1047717069 8:127605348-127605370 AGAAATGCCCATATGGAGCATGG - Intergenic
1048784983 8:138040960-138040982 AAAGGTCCCCAGAGGAAGCATGG + Intergenic
1049331968 8:142059427-142059449 ACGCATGCCCAGAGGCAGCGGGG + Intergenic
1050425522 9:5508999-5509021 GCAGATCCCCAGAGGAAGCACGG + Intergenic
1050664904 9:7924826-7924848 ATACATGCCAGGAGGAAGAAAGG + Intergenic
1051905105 9:22085794-22085816 AGACATGGTCAGAGAAAGGAGGG - Intergenic
1052164739 9:25311219-25311241 ATACAGGCCCTGAGGAAACATGG - Intergenic
1052697175 9:31892526-31892548 AGAAATCCCCAGCGGCAGCATGG + Intergenic
1053025893 9:34727895-34727917 AGACATACACAGTGGAAGCAGGG - Intronic
1055551650 9:77437051-77437073 AGGCATGCCCACAAGAAGCAAGG - Intronic
1055963052 9:81838861-81838883 AGATATGCCAAGAGCAACCATGG - Intergenic
1056491062 9:87107638-87107660 AGACAAGCCCACAGGAAAGATGG + Intergenic
1058164087 9:101601236-101601258 AGACAGAACCAGATGAAGCAGGG + Intronic
1059412292 9:114139925-114139947 AAAGATGCCCAGAGGAACAAGGG + Intergenic
1059923005 9:119178950-119178972 TGGCAGGTCCAGAGGAAGCAAGG - Intronic
1062237383 9:135516790-135516812 AGACAAGCACAGAGGGTGCAGGG - Intergenic
1186935978 X:14450351-14450373 AGACTTCCCCTGAGGGAGCAGGG + Intergenic
1189073686 X:37891835-37891857 AGAGATGCCCAGAGAATGTAAGG - Intronic
1189831740 X:44981436-44981458 TGACATGCCCAGAGAGGGCATGG - Intronic
1190465544 X:50722227-50722249 AGAGATGTCCAGAGGAAGGAGGG + Intronic
1191829567 X:65401821-65401843 AGACATGCCCTGAGCCAGAAAGG + Intronic
1194239446 X:91426169-91426191 TGACATGCTTACAGGAAGCATGG - Intergenic
1194376295 X:93137553-93137575 AGCCATGCCCAGCAGAACCATGG + Intergenic
1194803407 X:98298933-98298955 ACCCATTCCCAGAGGAAGTATGG + Intergenic
1195498573 X:105566946-105566968 AGATATCCCCAGAGGAACTATGG + Intronic
1195551824 X:106180233-106180255 AGAGATGCCCAGGGAAAGCTGGG - Intronic
1196650500 X:118163854-118163876 AGATGTGCCCAGAAGCAGCATGG - Intergenic
1199189140 X:144950320-144950342 AGACATACCCTGAGCAAGAAGGG + Intergenic
1199424951 X:147690645-147690667 AGAGAAGCCCATGGGAAGCATGG + Intergenic
1200033049 X:153311834-153311856 AAACATGGCCAGAGGACACAGGG - Intergenic
1201716011 Y:17044539-17044561 TGTCATGCACAGAGGAAGAACGG + Intergenic