ID: 1156966514

View in Genome Browser
Species Human (GRCh38)
Location 18:43100685-43100707
Sequence AACTGGATGTGGAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156966511_1156966514 -5 Left 1156966511 18:43100667-43100689 CCAAGGAAATTACTTATGAACTG 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1156966514 18:43100685-43100707 AACTGGATGTGGAAGTATGAAGG 0: 1
1: 0
2: 0
3: 18
4: 230
1156966509_1156966514 21 Left 1156966509 18:43100641-43100663 CCTCTGGATATACATAGAAGACA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1156966514 18:43100685-43100707 AACTGGATGTGGAAGTATGAAGG 0: 1
1: 0
2: 0
3: 18
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156966514 Original CRISPR AACTGGATGTGGAAGTATGA AGG Intronic
900990952 1:6098064-6098086 AACTGGATGTGGGGGTGAGAAGG + Intronic
902455119 1:16527869-16527891 AACAGGATGTGGACTTAGGAGGG + Intergenic
905949922 1:41941484-41941506 ATTTGGTGGTGGAAGTATGAGGG + Intronic
907152301 1:52300151-52300173 GAGTGGCTGTGGAAGTATGCTGG - Intronic
911014953 1:93322318-93322340 AACTAGATGTGAATTTATGAAGG + Intergenic
911737897 1:101357667-101357689 AGCTGGAGGTGAAAGCATGATGG + Intergenic
913997879 1:143666231-143666253 ATCTGGACGTGGAAGAATGAAGG - Intergenic
914508286 1:148308162-148308184 ATCTGGACGTGGAAGAATGAAGG - Intergenic
914972200 1:152317430-152317452 ATGTGGATTTGGAAATATGAAGG - Intronic
915823510 1:159051178-159051200 ATCTGGAAGAGGAAGTATGGAGG + Intronic
915933724 1:160077629-160077651 AAGTGGAAGAGGAAGCATGATGG - Intergenic
916307056 1:163348511-163348533 ATCTGCAAGAGGAAGTATGAAGG - Intronic
917254859 1:173103592-173103614 AGCTGGATGGGGAAGTCAGAAGG + Intergenic
919208448 1:194449352-194449374 AACAGAATGAGGAACTATGATGG + Intergenic
919329369 1:196149926-196149948 AAATGTATGTGGAAATGTGAAGG + Intergenic
920146001 1:203861576-203861598 AACCGGAAGCGGAAGTGTGAAGG - Intergenic
921191012 1:212708742-212708764 AACTGCCTGTGGAAGTTGGATGG - Intergenic
923418302 1:233787184-233787206 ACGTGGATGTGGTAGGATGAAGG - Intergenic
923987269 1:239395349-239395371 AACAGGATGAGGAAGAAGGAGGG - Intronic
1065461789 10:25974605-25974627 AACTGGCTGGGGATGTTTGAGGG + Intronic
1065461995 10:25977834-25977856 ATCTGGAAGTGGAAGTGAGATGG - Intronic
1066246282 10:33586187-33586209 ATCTGCATTTGGAAATATGAGGG - Intergenic
1067561311 10:47306761-47306783 TACTGGATGGGGAACCATGAAGG + Intronic
1067983308 10:51112605-51112627 AACTAGATCTGGATGTATTATGG + Intronic
1068135483 10:52948471-52948493 GACTGGATGTGGAAGTTCCAAGG - Intergenic
1072743215 10:97922663-97922685 AACTGGATGGGGAGGAAAGACGG - Intronic
1072792006 10:98324863-98324885 AACTGGGTCTGGACGTTTGAGGG + Intergenic
1074432229 10:113403949-113403971 AACAGGATGTGCAAGCATGGTGG + Intergenic
1075436284 10:122445454-122445476 CACTGAATGTGGAATTAGGAAGG - Intergenic
1076266827 10:129115191-129115213 AACTGGATGTGGATGCCAGATGG + Intergenic
1076480402 10:130781553-130781575 AAATGGATGTGGAGGGATGTGGG - Intergenic
1079114027 11:17629223-17629245 CACTGGATCTGGATGTCTGAGGG - Exonic
1079658566 11:23012736-23012758 AAATGTATGTGGAAGTGTGCAGG - Intergenic
1080290038 11:30660742-30660764 AACAGGATGTAGAAGTATAGAGG - Intergenic
1081134240 11:39418729-39418751 AAATGTATGTGTGAGTATGAGGG + Intergenic
1081519799 11:43870895-43870917 AATTGGATGTGAAATTATGGAGG - Intergenic
1082138459 11:48577900-48577922 ATCTGGAAGTGGTAATATGATGG + Intergenic
1083302648 11:61746985-61747007 AACTGGATGTAGAAGCACGCTGG + Exonic
1087002184 11:93432339-93432361 AAATGGATGTGGAATAATGAGGG + Intronic
1087058037 11:93952572-93952594 GACTGGATGGGTGAGTATGACGG + Intergenic
1088074275 11:105827037-105827059 TTCTGGATGAGGAAGGATGAAGG - Intronic
1088665674 11:112091285-112091307 AACCGGATTTGGAAAGATGAAGG - Intronic
1091334217 11:134754439-134754461 AACTGGATGCGGTCATATGATGG - Intergenic
1091988942 12:4938798-4938820 AACTGGATGTGGAGGTGGGAAGG + Intergenic
1092751456 12:11723402-11723424 AACTGAAAGTGGAAGAAAGAAGG - Intronic
1092833032 12:12463724-12463746 AGCTGGATGTGGAAACATGTAGG + Intronic
1093428481 12:19056413-19056435 AACTGGCTGAAGAAGTATCAAGG + Intergenic
1097971478 12:65637939-65637961 AAGTGTTTGTGGAAGGATGAAGG + Intergenic
1099474001 12:83085675-83085697 AACTGTATGTGGAAATAATAGGG + Intronic
1099649833 12:85411700-85411722 AAGTGGATGGGGAAGAAAGACGG + Intergenic
1099888106 12:88556520-88556542 AACAGGATATGGAAGTAGAACGG + Intronic
1100439908 12:94607120-94607142 AAATGGATGTGCAAGTAAGAGGG - Intronic
1100913878 12:99395475-99395497 AATTGGATGTGCAAAGATGAGGG - Intronic
1102830140 12:115990661-115990683 AACTTGATCTGGAAGAATGGTGG + Intronic
1105966714 13:25391264-25391286 TACTGCAGGTTGAAGTATGAAGG - Intronic
1106636580 13:31534990-31535012 CACTGGATGTGAAAGGATTATGG - Intergenic
1106941213 13:34781674-34781696 AACTTTATGTGAAAGTATGTTGG - Intergenic
1107177509 13:37416152-37416174 AAAGGGATATTGAAGTATGATGG + Intergenic
1107812606 13:44214889-44214911 AACTGGATTTGTATGAATGAGGG - Intergenic
1108147522 13:47495262-47495284 AAGTGGATTAGGAAGGATGAAGG + Intergenic
1109272587 13:60271128-60271150 AACTGGAAGTAGGATTATGAAGG + Intergenic
1110053648 13:70937283-70937305 AATTTGAAGTGGAAATATGATGG - Intergenic
1110149414 13:72231497-72231519 AAATTAATGTGGTAGTATGATGG - Intergenic
1110306083 13:73988082-73988104 TACTGGAAGTGGCAGAATGAAGG - Intronic
1112401623 13:99083577-99083599 ATCTGGATGATGAAATATGAAGG + Intronic
1116556924 14:46322778-46322800 AACTGGATGTGTTAGAATGTGGG + Intergenic
1116693648 14:48144210-48144232 AGCTGGATGAGAAAGTATCAGGG - Intergenic
1118337734 14:64868299-64868321 AAGTAGATGTGGAAGTATGGGGG + Intronic
1118890654 14:69905723-69905745 AGTTGGATGTGGAAGGGTGAAGG + Intronic
1119099635 14:71867998-71868020 ATCTGGATATGGATGGATGATGG - Intergenic
1119801166 14:77446597-77446619 AAATCGATATGGAAGTATAAAGG + Intronic
1121426235 14:93854192-93854214 CAATGGAGGTGGAATTATGAAGG - Intergenic
1121599053 14:95189392-95189414 AAATGGATGTGGAAGTCTGCAGG - Exonic
1121642336 14:95494159-95494181 ATCTGGATGTGGAAGTCAAATGG - Intergenic
1124955463 15:34357277-34357299 AACAGGATATGGAAGTTTGCTGG - Exonic
1125515523 15:40317669-40317691 TACTGCATATGGAAGTATAACGG + Intergenic
1127234149 15:57029395-57029417 AAGTGCATATGGAAGTACGAAGG - Intronic
1127309908 15:57743497-57743519 ATCTGGATGTGGAAATACAAAGG - Intronic
1129228928 15:74185709-74185731 GACTGGATGTGGACGTAAGGTGG - Intronic
1130391345 15:83458399-83458421 CACTGGATTTGGAAGTCAGAAGG - Intronic
1132790306 16:1682717-1682739 AAATGGATATGGAAGTCAGATGG + Intronic
1136748878 16:32615473-32615495 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1138163899 16:54781707-54781729 ATGTGGATGTGGGAGTAGGAAGG - Intergenic
1139319518 16:66102334-66102356 CAGTGAATGGGGAAGTATGAGGG + Intergenic
1140036674 16:71376578-71376600 GATTGGATGTGGATGTATGTGGG - Intronic
1203051011 16_KI270728v1_random:874687-874709 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1144163490 17:12584427-12584449 AACAGGAGCTGGAAATATGAGGG - Intergenic
1145827973 17:27891571-27891593 AACTGGATCTCTAAGGATGAAGG - Intronic
1148127155 17:45242756-45242778 AACTGGAAGTGGAATCAGGAGGG - Intronic
1149947566 17:60946989-60947011 CACTAGATGTGCAAGTATTATGG - Intronic
1150868391 17:68878379-68878401 AGCTTGATGTGGAAGCTTGACGG + Intronic
1151009757 17:70481148-70481170 AACTGGGTGTGGAAATATTTAGG - Intergenic
1155071538 18:22321184-22321206 AGATGGATGTGGATATATGAAGG + Intergenic
1156966514 18:43100685-43100707 AACTGGATGTGGAAGTATGAAGG + Intronic
1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG + Intergenic
1158341150 18:56468036-56468058 AACAGCATGTGGAAGGAAGAAGG + Intergenic
1158387341 18:57010108-57010130 AACTCCATGTGGAAGCAGGAGGG + Intronic
1159418304 18:68182586-68182608 AACTGAGTGTGGAAGAATCAGGG - Intergenic
1162956339 19:14100715-14100737 ACCTGCATGTTGAAGTATGCTGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164816430 19:31207281-31207303 AAATGGATTTGGAAATATAATGG - Intergenic
1167148085 19:47694538-47694560 AACTGGAGCTGGAAGTCGGATGG - Exonic
1167555732 19:50194220-50194242 AACTGGATGTAGAGGTAAGAAGG + Intronic
925063153 2:909147-909169 AGCAGGCTGTGGAAGTAGGAGGG - Intergenic
925086217 2:1109389-1109411 AAAAGGATGTGGAAGTCAGAGGG + Intronic
925928634 2:8688728-8688750 AACTGGTTGTGGCAGTAGAAGGG + Intergenic
929043372 2:37768317-37768339 AACAGGAGGTGGAAGATTGATGG - Intergenic
929045543 2:37785473-37785495 AAGTGGATGTGGAAGCAGGCAGG - Intergenic
929341531 2:40824803-40824825 TAATGGAAGTGGAAGTATGAGGG + Intergenic
930564486 2:53002324-53002346 TACTGGATATGCAAGTGTGAAGG - Intergenic
932178731 2:69626394-69626416 AATTGGATTTGGAAATATGGAGG - Intronic
935225928 2:101053149-101053171 AACTGAATTTTGAAGGATGATGG + Intronic
935495331 2:103774113-103774135 AAGAGGATGTGGAATGATGAAGG + Intergenic
936072332 2:109379526-109379548 GAAGGGATGTGAAAGTATGAAGG + Intronic
936672886 2:114679562-114679584 AACCTGATGTGGAAGAATAAGGG + Intronic
936992592 2:118382095-118382117 AACTGTATGTGGATGTGGGAGGG - Intergenic
937339226 2:121080269-121080291 ATCTGGAGCTGGAAGTTTGAAGG + Intergenic
938728399 2:134126902-134126924 AACTGGAGGTGAAAATAAGATGG - Intronic
942073140 2:172333224-172333246 ATATGGAGATGGAAGTATGAGGG - Intergenic
942352861 2:175071664-175071686 AACTGGATGAGGAATCATAAAGG + Intergenic
943926771 2:193794216-193794238 ATCTGACTGTGGAAGTACGATGG + Intergenic
944533367 2:200685847-200685869 AGATGGAGATGGAAGTATGAAGG + Intergenic
944563911 2:200968317-200968339 AACTGGGTGTGGCAGTACAAAGG + Intergenic
944835344 2:203573763-203573785 GTCTGGATGTGGGAGTGTGAAGG + Intergenic
947104431 2:226653826-226653848 AACTGGGAGTGGAGGCATGAAGG + Intergenic
1169383613 20:5129021-5129043 TACAGGATGTGAAAGTAAGACGG - Intronic
1169493928 20:6095170-6095192 AACTGGGTGTGGGAGTAAGGAGG + Intronic
1173107271 20:40149788-40149810 AACCGGAGGAGGAAGGATGAGGG - Intergenic
1173198614 20:40937520-40937542 AACTGGATATGGAGGTGAGAGGG + Intergenic
1173446135 20:43120257-43120279 AACTGGATCTGGAAGTGGTAGGG - Intronic
1173599344 20:44281912-44281934 TATTGGATGTGGAAGTATTATGG + Intergenic
1177115017 21:17074733-17074755 AACCAAATGTGGATGTATGAGGG + Intergenic
1177432659 21:21010751-21010773 ACATGGATGTGGATGTGTGATGG + Intronic
1178796599 21:35750728-35750750 AACTTGAGGTGGAAGTGTGATGG - Intronic
1180597265 22:16986304-16986326 ACGTGCATGTGAAAGTATGAAGG + Intronic
1180728831 22:17966122-17966144 AGCAGGATGTGGCAGGATGAGGG - Intronic
1182374383 22:29835924-29835946 ACCTGGATGTTGAAGGATGGGGG + Intronic
1183107441 22:35624755-35624777 GCCTGGATGTGAACGTATGAGGG + Intronic
1183298921 22:37048817-37048839 AGCTGTATGGGGAAGAATGAGGG - Intergenic
1183573439 22:38671489-38671511 AGCTGAATGTGGAAGGATAATGG + Intronic
1185260484 22:49859084-49859106 AACAGCATGTGGAGGTCTGATGG - Intronic
949361955 3:3241949-3241971 TACTGGATGTGGATGTATTTTGG - Intergenic
950183186 3:10929181-10929203 AACTGGATGGGGAGATATGATGG - Exonic
951224702 3:20107767-20107789 CACTGGATTTGGAGGTTTGAAGG - Intronic
952484376 3:33795273-33795295 AAATGCAAGTGGAAGTAGGAGGG + Intergenic
952927762 3:38334221-38334243 GACTGAATGTGGAAACATGAAGG - Intergenic
953325573 3:42009935-42009957 AATTGGCTATGGAAGTATGAAGG - Intergenic
954880179 3:53830227-53830249 AAATGTATGTGGAAATATAAAGG + Intronic
954957155 3:54531341-54531363 AAGTTGATAGGGAAGTATGACGG + Intronic
955069009 3:55556617-55556639 ATCTGAATCTGGAAGGATGATGG + Intronic
956449644 3:69360877-69360899 AATTAGAAGTGGCAGTATGATGG + Intronic
959080328 3:101794171-101794193 TGCTGGAAGTGGAAGTTTGAGGG + Intronic
959573661 3:107911154-107911176 AACAGGATGTGGACTTATTAGGG + Intergenic
962501393 3:135997254-135997276 AACTGGATTTGCCAATATGAAGG - Intronic
962633292 3:137301762-137301784 CTCTGGATGTGGAAGTTAGAGGG + Intergenic
963885027 3:150572139-150572161 AGCTGGATTTGGAAATCTGAGGG + Exonic
964699957 3:159554882-159554904 AACTGGAGGTGGAAGCATATAGG - Intronic
965867028 3:173216878-173216900 CACTACATGTGGAAATATGATGG + Intergenic
966695810 3:182789851-182789873 AACTTGAAGTGGGAGGATGAAGG - Intergenic
966996858 3:185291147-185291169 AAACTGATGTGGAAGTATTATGG - Intronic
969161711 4:5265463-5265485 AACTGGAGGTGGATGGATGGCGG - Intronic
969173420 4:5381857-5381879 AACAGGATGTGTGCGTATGAAGG + Intronic
969931657 4:10636756-10636778 AACTGAATTTGGAAGGATGGAGG + Intronic
970581799 4:17480304-17480326 AATTTTATATGGAAGTATGACGG - Intronic
970776038 4:19675251-19675273 ACCTAGTTGTGGAACTATGAAGG + Intergenic
971057892 4:22934101-22934123 AAAGGGCTGTGGAAGTTTGAGGG + Intergenic
972356705 4:38285981-38286003 ATCTGGAGGGGAAAGTATGATGG - Intergenic
976604701 4:86971830-86971852 AACTGGGTGTTAAAGTTTGAAGG + Intronic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
979252557 4:118580713-118580735 AACTGGATGAGGGAGTATATGGG - Intergenic
979676935 4:123419784-123419806 CACTAGAGGTGGAAGGATGATGG + Intergenic
980283261 4:130750268-130750290 AATGGGATGTGAAAGTGTGAAGG - Intergenic
981056138 4:140363662-140363684 AAGTGGCTGTGAAATTATGATGG - Intronic
982999294 4:162392002-162392024 AACTGGATATGTCAGTGTGAGGG - Intergenic
987391502 5:17380443-17380465 AACTGGATGTTGCCGTATGTTGG + Intergenic
990315474 5:54578935-54578957 AAGTGTAGGTGTAAGTATGAGGG - Intergenic
990379531 5:55208568-55208590 AAATGTATGTGGCACTATGAGGG + Intergenic
990895285 5:60693266-60693288 AACTGGATGTGGAAGAGAGTAGG + Intronic
991977726 5:72199457-72199479 AACAGTATGTGGAAGTATCAGGG - Exonic
993057641 5:83000917-83000939 AACTGGTTGTGGAAGTTATATGG - Intergenic
993641132 5:90407581-90407603 AATTGGTTTTGGAACTATGAAGG - Intronic
998780366 5:145649768-145649790 GACAGGATGTAGAAGTTTGATGG - Intronic
998876904 5:146609476-146609498 AACTGGATGTGGAGCCAAGATGG + Intronic
999938303 5:156512776-156512798 ACATGGGTGTGGAAGTAGGAAGG - Intronic
1001521011 5:172393048-172393070 AAGTGTATGTGGAAATATAAAGG - Intronic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1005325173 6:24693018-24693040 GACAGGATGTGGCAGTGTGATGG - Intronic
1006175188 6:32117223-32117245 ATCTCGCTGTGGAAGTTTGAGGG - Intronic
1009989428 6:70823513-70823535 AACTGTATTTTGAAATATGATGG - Intronic
1011308917 6:85959657-85959679 AACTGGCTGTGGAAGTTCTAGGG + Intergenic
1011369398 6:86617198-86617220 AACTGGATCTTCAAGAATGAAGG + Intergenic
1011899877 6:92279007-92279029 AACTGGAAGTGGAAGAAATAAGG + Intergenic
1012025576 6:93986080-93986102 AGGTGGATGTGGTAGGATGATGG - Intergenic
1012216103 6:96586206-96586228 AAATGGATGTAGAAATATAAAGG + Intronic
1015723329 6:136269950-136269972 AACAGCATTTGGAAGGATGAGGG - Intronic
1016448066 6:144153099-144153121 AACTGGATGCCCAAGTATCAAGG + Intronic
1019566543 7:1683481-1683503 AAATGTATGTGGAAATATAAAGG - Intergenic
1019634596 7:2068843-2068865 CACTGGATGGGAAAGCATGAGGG + Intronic
1028103256 7:86847297-86847319 GACTGGATGTGTAAGTGTAAAGG + Intronic
1028721073 7:94032277-94032299 AAATGTGTGTGGAAGTTTGAAGG + Intergenic
1030173758 7:106630328-106630350 AACTGGCTGTGGATGAAGGAGGG - Intergenic
1030611314 7:111692589-111692611 CACTGCATGTGGAAGAGTGAAGG - Intergenic
1031599997 7:123695770-123695792 AACTGTATGTGGAAATGTGTTGG - Intronic
1032721763 7:134555774-134555796 AACTGGATGTGGAAGTTCTAAGG + Intronic
1033082969 7:138315111-138315133 AACTGGCATTGGAAGTAGGAGGG - Intergenic
1034750564 7:153564799-153564821 AACTGCAAGTGAAAGAATGAGGG - Intergenic
1037064700 8:14563301-14563323 AAATGGAAGTGGAAGAAGGAGGG + Intronic
1039491376 8:37950138-37950160 AACTGAATTTGGCAGTATGAAGG - Intergenic
1040012618 8:42675052-42675074 AACTGGATGGGAGAATATGAGGG - Intergenic
1040795960 8:51290279-51290301 AAATGGATGTGCAAGTAGGGAGG - Intergenic
1044197552 8:89395892-89395914 AACAGAATGTGGAAGTTTTAAGG + Intergenic
1045422854 8:102033751-102033773 TACTGGATATGGAAGTAATAAGG - Intronic
1045773226 8:105770000-105770022 AAATGAAGGTGGAATTATGAAGG - Intronic
1045873024 8:106947421-106947443 CACTGGATGTGCAAGTAGAAAGG - Intergenic
1048038218 8:130698358-130698380 AACTGGTTGAAGAACTATGATGG - Intergenic
1048720836 8:137322502-137322524 AGCTGGATGGGGAAGGTTGAAGG + Intergenic
1051147682 9:14045890-14045912 AGCTGGATGAGAAAGGATGAAGG + Intergenic
1051227716 9:14919694-14919716 AGCTGGATCTGAAAGGATGAGGG + Intergenic
1051244432 9:15095419-15095441 GACTAGATGGGGCAGTATGAAGG - Intergenic
1051650947 9:19323485-19323507 TTCTGGGTGTGGAAGAATGATGG + Intronic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052035084 9:23671316-23671338 AACAGGCTTTTGAAGTATGATGG + Intergenic
1052518012 9:29508938-29508960 AACTGGGGGTGGTAGTATGGGGG + Intergenic
1053539881 9:38962615-38962637 AAGAGGATTTGGAAGAATGATGG + Intergenic
1053804237 9:41784765-41784787 AAGAGGATTTGGAAGAATGATGG + Intergenic
1054141045 9:61530694-61530716 AAGAGGATTTGGAAGAATGATGG - Intergenic
1054192544 9:61996260-61996282 AAGAGGATTTGGAAGAATGATGG + Intergenic
1054626259 9:67401301-67401323 AAGAGGATTTGGAAGAATGATGG - Intergenic
1054645861 9:67592431-67592453 AAGAGGATTTGGAAGAATGATGG - Intergenic
1056856281 9:90132274-90132296 AACTGCCGGTGGAAGTATGAGGG - Intergenic
1057889291 9:98856436-98856458 AACAGGATCTGTGAGTATGATGG - Intergenic
1058640726 9:107081694-107081716 AACTAGATGTGGAGGAAAGAAGG - Intergenic
1059308435 9:113372577-113372599 AACTGGAGGTTGAAGTAGGTTGG - Intergenic
1059338798 9:113585752-113585774 AACTTGGTGAGGAAGTATGCTGG - Intronic
1059772755 9:117443233-117443255 AAATTGATGTGCAAGTAAGAAGG - Intergenic
1061392127 9:130323020-130323042 ATTTGGATCTGGAATTATGAGGG - Intronic
1061915687 9:133752109-133752131 AAATGGATGAGGAAGTAGAATGG - Intergenic
1186370874 X:8946263-8946285 AGCTGGTTGTGAAAATATGATGG - Intergenic
1187181232 X:16945980-16946002 AACTGGTTTTGGAGGAATGAAGG + Intergenic
1191659899 X:63638404-63638426 GACTAGATGTGGAAGTGTGTAGG - Intronic
1193186743 X:78522385-78522407 AAATGGATGGGGATGTCTGATGG + Intergenic
1194431382 X:93811171-93811193 AATTGGATGTGGTGGTATGAGGG + Intergenic
1195413372 X:104593648-104593670 AACTGGAAGTGAAAGAAGGATGG - Intronic
1195905562 X:109840806-109840828 AAATGGATGGGGAAATAGGAGGG + Intergenic
1196710471 X:118756959-118756981 AACTGGATGTGAGTGGATGAGGG + Intronic
1198802636 X:140462974-140462996 ACCAGGATGGGGAAGTAAGATGG - Intergenic
1198993510 X:142545084-142545106 AACTGGATGAGAAAGGGTGAAGG - Intergenic