ID: 1156969659

View in Genome Browser
Species Human (GRCh38)
Location 18:43139619-43139641
Sequence GCCAGCTGGCCCCCCAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156969651_1156969659 17 Left 1156969651 18:43139579-43139601 CCGGGTGGGCATGGGCTTGGCGG 0: 43
1: 476
2: 527
3: 385
4: 516
Right 1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG No data
1156969657_1156969659 -8 Left 1156969657 18:43139604-43139626 CCTGCACTCGGAGCGGCCAGCTG No data
Right 1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG No data
1156969656_1156969659 -7 Left 1156969656 18:43139603-43139625 CCCTGCACTCGGAGCGGCCAGCT No data
Right 1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG No data
1156969647_1156969659 29 Left 1156969647 18:43139567-43139589 CCAGCTAGAGTTCCGGGTGGGCA 0: 7
1: 98
2: 614
3: 638
4: 539
Right 1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156969659 Original CRISPR GCCAGCTGGCCCCCCAGCCC CGG Intergenic
No off target data available for this crispr