ID: 1156972657

View in Genome Browser
Species Human (GRCh38)
Location 18:43175467-43175489
Sequence TGACATAGAACGTACTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156972657_1156972659 16 Left 1156972657 18:43175467-43175489 CCTGATGAGTACGTTCTATGTCA No data
Right 1156972659 18:43175506-43175528 CTGTTGAGACACAGCGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156972657 Original CRISPR TGACATAGAACGTACTCATC AGG (reversed) Intergenic
No off target data available for this crispr