ID: 1156976578

View in Genome Browser
Species Human (GRCh38)
Location 18:43228893-43228915
Sequence CAGAGTTTCCACTATGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156976575_1156976578 4 Left 1156976575 18:43228866-43228888 CCAGTAAGAATAAAGCAGTTAAA No data
Right 1156976578 18:43228893-43228915 CAGAGTTTCCACTATGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156976578 Original CRISPR CAGAGTTTCCACTATGCTCT GGG Intergenic
No off target data available for this crispr