ID: 1156987695

View in Genome Browser
Species Human (GRCh38)
Location 18:43368269-43368291
Sequence ATGCTTGCTGCAACTTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156987695_1156987697 2 Left 1156987695 18:43368269-43368291 CCTATTCAAGTTGCAGCAAGCAT No data
Right 1156987697 18:43368294-43368316 AAGGTAATATTTTCTAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156987695 Original CRISPR ATGCTTGCTGCAACTTGAAT AGG (reversed) Intergenic
No off target data available for this crispr