ID: 1156990307

View in Genome Browser
Species Human (GRCh38)
Location 18:43400806-43400828
Sequence AGTTATCTGCAGAAGACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156990299_1156990307 25 Left 1156990299 18:43400758-43400780 CCACCAACGCCCAGTAATAGCCC No data
Right 1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG No data
1156990301_1156990307 16 Left 1156990301 18:43400767-43400789 CCCAGTAATAGCCCAAGAGCCAT No data
Right 1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG No data
1156990304_1156990307 4 Left 1156990304 18:43400779-43400801 CCAAGAGCCATCTCTCAAAAAGA No data
Right 1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG No data
1156990303_1156990307 5 Left 1156990303 18:43400778-43400800 CCCAAGAGCCATCTCTCAAAAAG No data
Right 1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG No data
1156990300_1156990307 22 Left 1156990300 18:43400761-43400783 CCAACGCCCAGTAATAGCCCAAG No data
Right 1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG No data
1156990305_1156990307 -3 Left 1156990305 18:43400786-43400808 CCATCTCTCAAAAAGAGAGTAGT No data
Right 1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG No data
1156990302_1156990307 15 Left 1156990302 18:43400768-43400790 CCAGTAATAGCCCAAGAGCCATC No data
Right 1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156990307 Original CRISPR AGTTATCTGCAGAAGACGGC AGG Intergenic
No off target data available for this crispr