ID: 1156996744

View in Genome Browser
Species Human (GRCh38)
Location 18:43478380-43478402
Sequence TTGACAATGGATAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156996744_1156996748 27 Left 1156996744 18:43478380-43478402 CCTTCCTCCTTATCCATTGTCAA No data
Right 1156996748 18:43478430-43478452 TTATAAATCTGTAAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156996744 Original CRISPR TTGACAATGGATAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr