ID: 1156997127

View in Genome Browser
Species Human (GRCh38)
Location 18:43482149-43482171
Sequence TAGAACAGTCGAGAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156997127_1156997131 11 Left 1156997127 18:43482149-43482171 CCTGCTGTCTCTCGACTGTTCTA No data
Right 1156997131 18:43482183-43482205 TCCGTCCACCCACTCCCCATCGG No data
1156997127_1156997136 22 Left 1156997127 18:43482149-43482171 CCTGCTGTCTCTCGACTGTTCTA No data
Right 1156997136 18:43482194-43482216 ACTCCCCATCGGACCTCAGCTGG No data
1156997127_1156997138 24 Left 1156997127 18:43482149-43482171 CCTGCTGTCTCTCGACTGTTCTA No data
Right 1156997138 18:43482196-43482218 TCCCCATCGGACCTCAGCTGGGG No data
1156997127_1156997137 23 Left 1156997127 18:43482149-43482171 CCTGCTGTCTCTCGACTGTTCTA No data
Right 1156997137 18:43482195-43482217 CTCCCCATCGGACCTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156997127 Original CRISPR TAGAACAGTCGAGAGACAGC AGG (reversed) Intergenic
No off target data available for this crispr