ID: 1156997839

View in Genome Browser
Species Human (GRCh38)
Location 18:43489424-43489446
Sequence CTATTGGAAGGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156997830_1156997839 11 Left 1156997830 18:43489390-43489412 CCGGGCACTCCAGACTGAGCAAT No data
Right 1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG No data
1156997829_1156997839 22 Left 1156997829 18:43489379-43489401 CCATGATCATGCCGGGCACTCCA No data
Right 1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG No data
1156997831_1156997839 2 Left 1156997831 18:43489399-43489421 CCAGACTGAGCAATAGAGCTAGA No data
Right 1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156997839 Original CRISPR CTATTGGAAGGGAGGGAAGA AGG Intergenic
No off target data available for this crispr