ID: 1156999719

View in Genome Browser
Species Human (GRCh38)
Location 18:43510107-43510129
Sequence GGGAGTAGAAGCTGCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156999719_1156999728 16 Left 1156999719 18:43510107-43510129 CCACCCCTGCAGCTTCTACTCCC No data
Right 1156999728 18:43510146-43510168 TTTATGAAGAGGAGGAATCTTGG No data
1156999719_1156999729 17 Left 1156999719 18:43510107-43510129 CCACCCCTGCAGCTTCTACTCCC No data
Right 1156999729 18:43510147-43510169 TTATGAAGAGGAGGAATCTTGGG No data
1156999719_1156999727 8 Left 1156999719 18:43510107-43510129 CCACCCCTGCAGCTTCTACTCCC No data
Right 1156999727 18:43510138-43510160 AAAACGACTTTATGAAGAGGAGG No data
1156999719_1156999726 5 Left 1156999719 18:43510107-43510129 CCACCCCTGCAGCTTCTACTCCC No data
Right 1156999726 18:43510135-43510157 GTAAAAACGACTTTATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156999719 Original CRISPR GGGAGTAGAAGCTGCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr