ID: 1156999930

View in Genome Browser
Species Human (GRCh38)
Location 18:43511723-43511745
Sequence CTGGTCTGCTTGGGAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156999925_1156999930 -4 Left 1156999925 18:43511704-43511726 CCAATTTCTTTAGCTTTTCCTGG No data
Right 1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG No data
1156999923_1156999930 18 Left 1156999923 18:43511682-43511704 CCTTCTGGGTTTTCCTTAGTTTC No data
Right 1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG No data
1156999924_1156999930 5 Left 1156999924 18:43511695-43511717 CCTTAGTTTCCAATTTCTTTAGC No data
Right 1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG No data
1156999921_1156999930 26 Left 1156999921 18:43511674-43511696 CCCACTTTCCTTCTGGGTTTTCC No data
Right 1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG No data
1156999922_1156999930 25 Left 1156999922 18:43511675-43511697 CCACTTTCCTTCTGGGTTTTCCT No data
Right 1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156999930 Original CRISPR CTGGTCTGCTTGGGAAAAGA TGG Intergenic
No off target data available for this crispr