ID: 1157007930

View in Genome Browser
Species Human (GRCh38)
Location 18:43608683-43608705
Sequence CCTCCCAACCGCCCTCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157007924_1157007930 27 Left 1157007924 18:43608633-43608655 CCAAAATAGTGAACTTTGTACCC No data
Right 1157007930 18:43608683-43608705 CCTCCCAACCGCCCTCCTTTTGG No data
1157007926_1157007930 6 Left 1157007926 18:43608654-43608676 CCAATAGTTAATTTTTCAATCAT No data
Right 1157007930 18:43608683-43608705 CCTCCCAACCGCCCTCCTTTTGG No data
1157007925_1157007930 7 Left 1157007925 18:43608653-43608675 CCCAATAGTTAATTTTTCAATCA No data
Right 1157007930 18:43608683-43608705 CCTCCCAACCGCCCTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157007930 Original CRISPR CCTCCCAACCGCCCTCCTTT TGG Intergenic
No off target data available for this crispr