ID: 1157008949

View in Genome Browser
Species Human (GRCh38)
Location 18:43623016-43623038
Sequence CAAGTTCACAACATATTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157008948_1157008949 2 Left 1157008948 18:43622991-43623013 CCTCATCAATAGAAGGCAATAGT No data
Right 1157008949 18:43623016-43623038 CAAGTTCACAACATATTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157008949 Original CRISPR CAAGTTCACAACATATTTAA TGG Intergenic
No off target data available for this crispr