ID: 1157013303

View in Genome Browser
Species Human (GRCh38)
Location 18:43678854-43678876
Sequence ATGCCCTTCTAGAAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157013301_1157013303 2 Left 1157013301 18:43678829-43678851 CCATGGAAAAGGGACCTAACAAA No data
Right 1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157013303 Original CRISPR ATGCCCTTCTAGAAGACTGA AGG Intergenic
No off target data available for this crispr