ID: 1157015255

View in Genome Browser
Species Human (GRCh38)
Location 18:43704406-43704428
Sequence TTGAATATACGAACAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157015255_1157015259 20 Left 1157015255 18:43704406-43704428 CCATTGTCTGTTCGTATATTCAA No data
Right 1157015259 18:43704449-43704471 GTCATTTTCTCACTTCTAACAGG No data
1157015255_1157015256 -2 Left 1157015255 18:43704406-43704428 CCATTGTCTGTTCGTATATTCAA No data
Right 1157015256 18:43704427-43704449 AATCTCTCCTTTCCTCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157015255 Original CRISPR TTGAATATACGAACAGACAA TGG (reversed) Intergenic
No off target data available for this crispr