ID: 1157015549

View in Genome Browser
Species Human (GRCh38)
Location 18:43708291-43708313
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157015548_1157015549 -6 Left 1157015548 18:43708274-43708296 CCATCACTTGCATTTGGTGGAGA No data
Right 1157015549 18:43708291-43708313 TGGAGACTCACAGTCACGCAAGG No data
1157015545_1157015549 1 Left 1157015545 18:43708267-43708289 CCAGCTACCATCACTTGCATTTG No data
Right 1157015549 18:43708291-43708313 TGGAGACTCACAGTCACGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157015549 Original CRISPR TGGAGACTCACAGTCACGCA AGG Intergenic