ID: 1157020772

View in Genome Browser
Species Human (GRCh38)
Location 18:43778923-43778945
Sequence ATGTAACCAGAGATGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157020771_1157020772 5 Left 1157020771 18:43778895-43778917 CCAGGGTGATTTCTCTCTTCAAT No data
Right 1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG No data
1157020768_1157020772 23 Left 1157020768 18:43778877-43778899 CCAGAGAAAACACACAGGCCAGG No data
Right 1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG No data
1157020767_1157020772 26 Left 1157020767 18:43778874-43778896 CCTCCAGAGAAAACACACAGGCC No data
Right 1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157020772 Original CRISPR ATGTAACCAGAGATGAAACT AGG Intergenic
No off target data available for this crispr