ID: 1157028941

View in Genome Browser
Species Human (GRCh38)
Location 18:43881061-43881083
Sequence TGAAGAATCAGTAGGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157028941_1157028945 -10 Left 1157028941 18:43881061-43881083 CCTAGAGCCCTACTGATTCTTCA No data
Right 1157028945 18:43881074-43881096 TGATTCTTCAGGCCTGAGTTTGG No data
1157028941_1157028947 2 Left 1157028941 18:43881061-43881083 CCTAGAGCCCTACTGATTCTTCA No data
Right 1157028947 18:43881086-43881108 CCTGAGTTTGGTGCCTTCTTTGG No data
1157028941_1157028948 6 Left 1157028941 18:43881061-43881083 CCTAGAGCCCTACTGATTCTTCA No data
Right 1157028948 18:43881090-43881112 AGTTTGGTGCCTTCTTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157028941 Original CRISPR TGAAGAATCAGTAGGGCTCT AGG (reversed) Intergenic
No off target data available for this crispr